TkA01G087980 | RubberDandelionOmics

Gene overview

TkA01G087980

Reference: TK1151 Chr: Chr01 Coordinates: 22401439-22410898 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1674 bp · TkA01G087980|TK1151|cDNA

TAAAACACGCAAAACCTGTCAGAAGTTAAGCCAGAAATGGACATCAAAGTTTTTAAATTCGTATATAGCACCACATTAACACCATAATAGTCTAAAAAGGATCATAAAATTCATAATTCTGACACTAAAATGGCTTCCAATGTTCATTTTCTTATGATACCTCTAATGTGCCCAGGCCACCTCATTCCAATGGTGGACATGGCCAAACTCATAGCCCAACACTCTGCCACAGTCACCATCGTCATCACCCCCCGTAACGC...

CDS

Download CDS FASTA

1476 bp · TkA01G087980|TK1151|CDS

ATGGCTTCCAATGTTCATTTTCTTATGATACCTCTAATGTGCCCAGGCCACCTCATTCCAATGGTGGACATGGCCAAACTCATAGCCCAACACTCTGCCACAGTCACCATCGTCATCACCCCCCGTAACGCCGCCAGGTTCGGGGAGGTCCTCCACCGTGTTTTTGCCTCCGGCCACCCAATCCACATCCTCCAACTCCAATTTCCCGCCACAGAACACGGATTACCAGAAGGATGTGAAAACGTAGACGATCTACCCAC...

Protein

Download Protein FASTA

491 aa · TkA01G087980|TK1151|PROTEIN

MASNVHFLMIPLMCPGHLIPMVDMAKLIAQHSATVTIVITPRNAARFGEVLHRVFASGHPIHILQLQFPATEHGLPEGCENVDDLPTFKLTKNFFNASAKLQEPLEDIFNDLKPRPSCIISDKNLTWTADVAKKFEIPWVIFDGMSCFTQLATHNLCVSKVHERVGDFDPFLLPGLPDEITMTKSQLPGLFNPGKSPEAKKITSTRGEIRATEIGAYGILINSFEELERRYLDEFRKVKNVWCIGPFSLSNKNDLDKAQR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G087980`
TK1151 ID	TkA01G087980
OH-1004 ID	LXL04_005073
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	94.500
Protein coverage (%)	TK1151 99.593 / OH-1004 99.593 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G087980

Location Chr01:22401439-22410898 (+)

Description Similar to UGT73C3: UDP-glycosyltransferase 73C3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g36780`	UDP-glycosyltransferase 73C3.	No verified direct reference in this release
`At2g36790`	Acts as a UDP-glucose:flavonol-3-O-glycoside-7-O- glucosyltransferase. 6- and 7-hydroxyflavone, but not 3- or 5- hydroxyflavone are accepted as substrates.	UGT73C6 and UGT78D1, glycosyltransferases involved in flavonol glycoside biosynthesis in Arabidopsis thaliana.2003 · DOI: 10.1074/jbc.m303523200
`At2g36800`	Specifically catalyzes 23-O-glucosylation of brassinosteroids, resulting probably in their inactivation.	Detoxification of the Fusarium mycotoxin deoxynivalenol by a UDP-glucosyltransferase from Arabidopsis thaliana.2003 · DOI: 10.1074/jbc.m307552200 N-glucosylation of cytokinins by glycosyltransferases of Arabidopsis thaliana.2004 · DOI: 10.1074/jbc.m409569200 The UGT73C5 of Arabidopsis thaliana glucosylates brassinosteroids.2005 · DOI: 10.1073/pnas.0504279102
`At3g53150`	UDP-glycosyltransferase 73D1.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005073 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009617 response to bacterium Biological Process

GO:0009636 response to toxic substance Biological Process

GO:0010224 response to UV-B Biological Process

GO:0016131 brassinosteroid metabolic process Biological Process

GO:0016134 saponin metabolic process Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0098754 detoxification Biological Process

GO:0005783 endoplasmic reticulum Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0008194 UDP-glycosyltransferase activity Molecular Function

GO:0035251 UDP-glucosyltransferase activity Molecular Function

KEGG gene cross-reference

ag:AFN26667

ath:AT2G36750

ath:AT2G36770

ath:AT2G36780

ath:AT2G36800

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.804

Rank 1 · TkA01G087980 · TK1151

Nucleus0.215

Rank 2 · TkA01G087980 · TK1151

Endoplasmic reticulum0.058

Rank 3 · TkA01G087980 · TK1151

Peroxisome0.051

Rank 4 · TkA01G087980 · TK1151

Plastid0.049

Rank 5 · TkA01G087980 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF26168Glyco_transf_N4-123 aa

PF10307HAD_SAK_121-58 aa

PF18176KptA_kDCL152-180 aa

PF26168Glyco_transf_N213-247 aa

PF00201UDPGT282-409 aa

PF18176KptA_kDCL316-365 aa

PF07249Cerato-platanin343-420 aa

PF06722EryCIII-like_C349-412 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G087980	`PF26168`	Glyco_transf_N	4	123	0.00017	22.3
TkA01G087980	`PF10307`	HAD_SAK_1	21	58	0.044	14.3
TkA01G087980	`PF18176`	KptA_kDCL	152	180	0.26	12.1
TkA01G087980	`PF26168`	Glyco_transf_N	213	247	0.00017	22.3
TkA01G087980	`PF00201`	UDPGT	282	409	2.5e-18	66.9
TkA01G087980	`PF18176`	KptA_kDCL	316	365	0.26	12.1
TkA01G087980	`PF07249`	Cerato-platanin	343	420	0.13	13.1
TkA01G087980	`PF06722`	EryCIII-like_C	349	412	0.038	14.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZQ96`	Arabidopsis thaliana	sp\|Q9ZQ96\|U73C3_ARATH UDP-glycosyltransferase 73C3	47.200%	Swiss-Prot	Medium
`Q9ZQ95`	Arabidopsis thaliana	sp\|Q9ZQ95\|U73C6_ARATH UDP-glycosyltransferase 73C6	45.500%	Swiss-Prot	Medium
`Q9ZQ94`	Arabidopsis thaliana	sp\|Q9ZQ94\|U73C5_ARATH UDP-glycosyltransferase 73C5	45.900%	Swiss-Prot	Medium
`Q9SCP6`	Arabidopsis thaliana	sp\|Q9SCP6\|U73D1_ARATH UDP-glycosyltransferase 73D1	45.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card