TkA01G018460 | RubberDandelionOmics

Gene overview

TkA01G018460

Reference: TK1151 Chr: Chr01 Coordinates: 4706623-4707135 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

513 bp · TkA01G018460|TK1151|cDNA

TTAGGCTATTCGGTACGGGTAAACGCCGAGAAGAACGCGGCCTACGTGGAGGCGAGAACGCCGTCTTCGACAACCCAACACCGCGCCCAGCTTCGCGTTGCACCTTCTCGCGTCGTCCCGCGTCGCTATTCCAACGGCGAGCAACGCCGCGTTGGTTCTCTTCCTTCTCCCTTTTTCTTCTCTTCTCTTCTTTTTCCTTGCCTTCGATCTTCTTTGTCTCTATTTTGCTGTGTATACAGTCGCCCAAAACATAGGTTTTT...

CDS

Download CDS FASTA

513 bp · TkA01G018460|TK1151|CDS

TTAGGCTATTCGGTACGGGTAAACGCCGAGAAGAACGCGGCCTACGTGGAGGCGAGAACGCCGTCTTCGACAACCCAACACCGCGCCCAGCTTCGCGTTGCACCTTCTCGCGTCGTCCCGCGTCGCTATTCCAACGGCGAGCAACGCCGCGTTGGTTCTCTTCCTTCTCCCTTTTTCTTCTCTTCTCTTCTTTTTCCTTGCCTTCGATCTTCTTTGTCTCTATTTTGCTGTGTATACAGTCGCCCAAAACATAGGTTTTT...

Protein

Download Protein FASTA

170 aa · TkA01G018460|TK1151|PROTEIN

LGYSVRVNAEKNAAYVEARTPSSTTQHRAQLRVAPSRVVPRRYSNGEQRRVGSLPSPFFFSSLLFPCLRSSLSLFCCVYSRPKHRFLVFEMEEGFEDGGVGMKKMKSFCFKNCILVLRLYILFNLCFKNCILVPRLYILINLCFKNCVPSPRLYILINLCFLIIVILLFL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G018460`
TK1151 ID	TkA01G018460
OH-1004 ID	LXL04_031320
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	50.500
Protein coverage (%)	TK1151 57.059 / OH-1004 13.768 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA01G018460`
Location	Chr01:4706623-4707135 (+)
Description	Similar to SCL1: Scarecrow-like protein 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_031320` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006351 DNA-templated transcription Biological Process GO:0006355 regulation of DNA-templated transcription Biological Process GO:0009585 red, far-red light phototransduction Biological Process GO:0009640 photomorphogenesis Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0000976 transcription cis-regulatory region binding Molecular Function GO:0003700 DNA-binding transcription factor activity Molecular Function GO:0043565 sequence-specific DNA binding Molecular Function
KEGG gene cross-reference	ath:AT1G21450 ath:AT1G50600 ath:AT5G48150 dosa:Os07g0545800 dosa:Os07g0583600 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.419

Rank 1 · TkA01G018460 · TK1151

Cytoplasm0.404

Rank 2 · TkA01G018460 · TK1151

Cell membrane0.153

Rank 3 · TkA01G018460 · TK1151

Endoplasmic reticulum0.118

Rank 4 · TkA01G018460 · TK1151

Mitochondrion0.057

Rank 5 · TkA01G018460 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02953zf-Tim10_DDP103-114 aa

PF02953zf-Tim10_DDP124-131 aa

PF02953zf-Tim10_DDP140-150 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G018460	`PF02953`	zf-Tim10_DDP	103	114	0.036	14.3
TkA01G018460	`PF02953`	zf-Tim10_DDP	124	131	0.036	14.3
TkA01G018460	`PF02953`	zf-Tim10_DDP	140	150	0.036	14.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card