TkA01G007850 | RubberDandelionOmics

Gene overview

TkA01G007850

Reference: TK1151 Chr: Chr01 Coordinates: 2040370-2047643 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1319 bp · TkA01G007850|TK1151|cDNA

CAAAATTCGAACTCGTATAAAATCCCCCTTATCTCAAAAACCTTCCCATTCCAGCCGTTGGTTTAAAGACTCTGTTCATCTTCTTCAAAACTACAATTCTGCAACTGAGAAGGTTAAACACCAAAAGAATCAGTAGATATGTCCTTCGATCTTCCACCGGAGGTGTTGGAAGTGCTTCCTTCCGATCCATTTGAACAGCTCGATATCGCACGCAGAATCACTTCCATTGCGCTTTGCACTCGAATCACCTCCCTTGAATC...

CDS

Download CDS FASTA

852 bp · TkA01G007850|TK1151|CDS

ATGTCCTTCGATCTTCCACCGGAGGTGTTGGAAGTGCTTCCTTCCGATCCATTTGAACAGCTCGATATCGCACGCAGAATCACTTCCATTGCGCTTTGCACTCGAATCACCTCCCTTGAATCGGAGTCCTCCGCCCTCCGCGACGAGCTTAACGACAGGGAACTTGTTGTCGAAGACCTGCAGACTCAAATTGACTCTCTTAACTCTTCTCTCTCCGACGTTTTCGACCAACTTTCCCGCGCTGATCAAGAGAAAGAGAA...

Protein

Download Protein FASTA

283 aa · TkA01G007850|TK1151|PROTEIN

MSFDLPPEVLEVLPSDPFEQLDIARRITSIALCTRITSLESESSALRDELNDRELVVEDLQTQIDSLNSSLSDVFDQLSRADQEKENLLNENASLSEQVNKLNRDVAKLQSFRKTLMMSLQDDEGNSARNKKPPVIAPLSEDEQTSYQDEPVKDASRTQATTPGLFLTPPGSPPSVSASGSPTRRHSVSFSTTRNMSDDRSSSSSIFSSTTSTPYTSMAGRTRVDGKEFFRQVRGRLSYDQFGAFLANVKELNSHKQTKE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G007850`
TK1151 ID	TkA01G007850
OH-1004 ID	LXL04_005908
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	95.500
Protein coverage (%)	TK1151 98.587 / OH-1004 96.321 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G007850

Location Chr01:2040370-2047643 (+)

Description Similar to At4g15545: Uncharacterized protein At4g15545

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g15545`	Uncharacterized protein At4g15545.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005908 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0080119 ER body organization Biological Process

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0010168 ER body Cellular Component

KEGG gene cross-reference

ath:AT4G15545

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.724

Rank 1 · TkA01G007850 · TK1151

Nucleus0.316

Rank 2 · TkA01G007850 · TK1151

Golgi apparatus0.060

Rank 3 · TkA01G007850 · TK1151

Lysosome / Vacuole0.059

Rank 4 · TkA01G007850 · TK1151

Cell membrane0.057

Rank 5 · TkA01G007850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25802WWC120-70 aa

PF24481CT398_CC23-111 aa

PF05266DUF72424-115 aa

PF07321YscO24-98 aa

PF30907IPGA1_CC29-59 aa

PF28968PMD1-like31-109 aa

PF28231STB2_C31-110 aa

PF16471JIP_LZII31-71 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G007850	`PF25802`	WWC1	20	70	1.7	9.3
TkA01G007850	`PF24481`	CT398_CC	23	111	0.026	15.1
TkA01G007850	`PF05266`	DUF724	24	115	0.012	16.2
TkA01G007850	`PF07321`	YscO	24	98	1.1	10.1
TkA01G007850	`PF30907`	IPGA1_CC	29	59	0.87	10.7
TkA01G007850	`PF28968`	PMD1-like	31	109	0.0027	17.9
TkA01G007850	`PF28231`	STB2_C	31	110	0.0031	18.7
TkA01G007850	`PF16471`	JIP_LZII	31	71	0.0092	16.9
TkA01G007850	`PF27720`	SSNA1	31	80	0.026	15.4
TkA01G007850	`PF25450`	Rab11-FIP3	31	86	0.03	15.3
TkA01G007850	`PF23177`	bHLH_IRO3	31	50	0.65	11.1
TkA01G007850	`PF25764`	KIF21A_4th	32	126	0.00023	21.6
TkA01G007850	`PF30829`	MIA2_CC	32	124	0.005	15.7
TkA01G007850	`PF27017`	GOSR1_N	32	113	0.044	14.7
TkA01G007850	`PF24555`	CC4_CEP85	32	69	0.24	12.6
TkA01G007850	`PF23991`	DUF7310	32	67	0.55	11.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93W28`	Arabidopsis thaliana	sp\|Q93W28\|Y4554_ARATH Uncharacterized protein At4g15545	54.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card