TkA01G001840 | RubberDandelionOmics

Gene overview

TkA01G001840

Reference: TK1151 Chr: Chr01 Coordinates: 487060-497199 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1788 bp · TkA01G001840|TK1151|cDNA

TTTCAATGACGAGTGTGTGAAGCAATTCATTCCTTTATAGGAGGGAAAATAGCTAATGACCATAATGCCCTTAATACAATTGAACAATTAACAAAAATCTTATCAACCTAAAAATCGGCCGCGACATCACTTCTACCTCGCCTCTTCCTCGCTTCTTCCTCACTGTTCACGACCTCCATTTGGCTTCACGACATCCATCTGTTCAGTAGTTGCGTGTGCCACCGTGTGCACCATACCAGCTCTGTCGTTGGCTGTAGCTC...

CDS

Download CDS FASTA

1143 bp · TkA01G001840|TK1151|CDS

ATGGCGTTATTACTCCGTGGTTTTTGTAAACCTTGTCGTTATCTTCAACCCCTTCATCAGCATATATCTCAATCCATTTCCCCACCCCCAAAACCTAGTTTACACAGACAAAATCACGAATTTTACATCCCCAGCTTCGACACCTCCAAGTTGAAATACTTTAATTTGATAAGATTAAGTCAGAGTTATGGCATTTCCACTTCCTCAAGTAGTTTAAGGGATGAAGAAAAGGAAAAACGTAATGGGGATAAAAAGATTTC...

Protein

Download Protein FASTA

380 aa · TkA01G001840|TK1151|PROTEIN

MALLLRGFCKPCRYLQPLHQHISQSISPPPKPSLHRQNHEFYIPSFDTSKLKYFNLIRLSQSYGISTSSSSLRDEEKEKRNGDKKISWIDLYLPEKIRPYAHLARLDKPIGTWLLAWPCMWSITLAASPGHLPDMKMLTLFGCGAFLLRGAGCTINDLLDRDIDTKVERTKSRPIASGALTPFEGVGFLGFQLLLGLGILLQLNNYSRILGASSLLLVFSYPLMKRITFWPQAYLGLTFNWGALLGWSAIRGSLDPRVVL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA01G001840`
TK1151 ID	TkA01G001840
OH-1004 ID	LXL04_006010
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	97.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA01G001840

Location Chr01:487060-497199 (-)

Description Similar to PPT1: 4-hydroxybenzoate polyprenyltransferase, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g23660`	Catalyzes the prenylation of para-hydroxybenzoate (PHB) with an all-trans polyprenyl group.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006010 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006071 glycerol metabolic process Biological Process

GO:0006744 ubiquinone biosynthetic process Biological Process

GO:0008299 isoprenoid biosynthetic process Biological Process

GO:0009625 response to insect Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005743 mitochondrial inner membrane Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0031314 extrinsic component of mitochondrial inner membrane Cellular Component

GO:0004337 (2E,6E)-farnesyl diphosphate synthase activity Molecular Function

GO:0004659 prenyltransferase activity Molecular Function

GO:0008412 4-hydroxybenzoate polyprenyltransferase activity Molecular Function

KEGG gene cross-reference

ag:BAB84122

ag:BAB84123

ath:AT4G23660

bta:504633

rno:498332

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.901

Rank 1 · TkA01G001840 · TK1151

Plastid0.043

Rank 2 · TkA01G001840 · TK1151

Nucleus0.033

Rank 3 · TkA01G001840 · TK1151

Cytoplasm0.033

Rank 4 · TkA01G001840 · TK1151

Cell membrane0.017

Rank 5 · TkA01G001840 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01040UbiA116-361 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA01G001840	`PF01040`	UbiA	116	361	4.7e-61	206.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93YP7`	Arabidopsis thaliana	sp\|Q93YP7\|COQ2_ARATH 4-hydroxybenzoate polyprenyltransferase, mitochondrial	76.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card