LXL04_037841 | RubberDandelionOmics

Gene overview

LXL04_037841

Reference: OH-1004 Chr: Chr09 Coordinates: 22466651-22469233 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

588 bp · LXL04_037841|LXL04_037841|OH1004|cDNA

ATGGCAGTAACTCGAACAAGACTTTATTCTTTTACTGGTATTGGATTGCTGGAGCGAGTTGAATTTTTTCATCAAGCAAAGAAGAGCAGTCCATTTTGCTTGGCTTTCAGGAGTTGGTATCTACCTAGTTCTATTGCACTTTTGGAATTCCACTTTTTGCTCCTAATTGGAAACAGGGTCAAAGATGTAAATAGAATCAGTGAACAAATTGTGGAAGAACTTGAGtttgacaaaacttcagagacAACTTCTAAAGGGAT...

CDS

Download CDS FASTA

588 bp · LXL04_037841|LXL04_037841|OH1004|CDS

ATGGCAGTAACTCGAACAAGACTTTATTCTTTTACTGGTATTGGATTGCTGGAGCGAGTTGAATTTTTTCATCAAGCAAAGAAGAGCAGTCCATTTTGCTTGGCTTTCAGGAGTTGGTATCTACCTAGTTCTATTGCACTTTTGGAATTCCACTTTTTGCTCCTAATTGGAAACAGGGTCAAAGATGTAAATAGAATCAGTGAACAAATTGTGGAAGAACTTGAGTTTGACAAAACTTCAGAGACAACTTCTAAAGGGAT...

Protein

Download Protein FASTA

195 aa · LXL04_037841|LXL04_037841|OH1004|PROTEIN

MAVTRTRLYSFTGIGLLERVEFFHQAKKSSPFCLAFRSWYLPSSIALLEFHFLLLIGNRVKDVNRISEQIVEELEFDKTSETTSKGIIGLSIDASPGCLYAYDENSIFQVSINRLLLEDVSPDNRNSEYKSIINYFRASLSDSKDVLDEATTMKLLESLEARPFGNIPTCDSILLDATVCANNMEFRPPFDDRSL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037841`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037841

Location Chr09:22466651-22469233 (+)

Description Similar to VPS18: Vacuolar sorting protein 18

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g12470`	Essential protein required during embryogenesis.	Distinct sets of tethering complexes, SNARE complexes, and Rab GTPases mediate membrane fusion at the vacuole in Arabidopsis.2018 · DOI: 10.1073/pnas.1717839115

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037841 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006886 intracellular protein transport Biological Process

GO:0006904 vesicle docking involved in exocytosis Biological Process

GO:0007032 endosome organization Biological Process

GO:0007033 vacuole organization Biological Process

GO:0010015 root morphogenesis Biological Process

GO:0048284 organelle fusion Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005768 endosome Cellular Component

GO:0009705 plant-type vacuole membrane Cellular Component

GO:0010008 endosome membrane Cellular Component

GO:0030897 HOPS complex Cellular Component

KEGG gene cross-reference

ath:AT1G12470

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.520

Rank 1 · LXL04_037841 · OH-1004

Cytoplasm0.372

Rank 2 · LXL04_037841 · OH-1004

Cell membrane0.077

Rank 3 · LXL04_037841 · OH-1004

Endoplasmic reticulum0.068

Rank 4 · LXL04_037841 · OH-1004

Golgi apparatus0.060

Rank 5 · LXL04_037841 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05131.21Pep3_Vps1814-112 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037841	`PF05131.21`	Pep3_Vps18	14	112	4e-13	49.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4IDS7`	Arabidopsis thaliana	Vacuolar sorting protein 18	70.423%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card