LXL04_037598 | RubberDandelionOmics

Gene overview

LXL04_037598

Reference: OH-1004 Chr: Chr09 Coordinates: 15629420-15633712 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1536 bp · LXL04_037598|LXL04_037598|OH1004|cDNA

CACGTCCAAGATCGATGTACACCGGCTCCACACCCAGTTAGCAACTCCCTTCACACGCTAAGCTGCCCCACGCCCAAAAAACACAGGTCAAAATATCAAACCCCTCATCACCACCAACCGACTACCGATCTCTCCCGGTCGTCGTCGTCGGTCGTCTTCATCTCCGGTGATCCAAATCGTCATCGTATAATCAGAACAGCTCGAATCGGAGAGATCTCTACGCCGAGTTGTTGTTTAATCTTATCGGCAAGTATGAACGA...

CDS

Download CDS FASTA

1284 bp · LXL04_037598|LXL04_037598|OH1004|CDS

ATGAACGAGAAGGCAGGTGTGTCCAAGGAACTCAATGCTAGGCACAGAAAGATACTTGAAGGCCTTCTTAAATTACCTGAAAATAGAGAGTGTGCTGATTGCAAAACCAAAGGTCCTCGATGGGCTAGTGTGAACCTAGGCATCTTTATTTGCATGCAATGTTCTGGAATCCACAGAAGCCTTGGAGTACACATCTCAAAGGTGCGATCAGCTACACTCGACACATGGCTTCCAGAGCAAGTTGCATTTATCCAGTCCAT...

Protein

Download Protein FASTA

427 aa · LXL04_037598|LXL04_037598|OH1004|PROTEIN

MNEKAGVSKELNARHRKILEGLLKLPENRECADCKTKGPRWASVNLGIFICMQCSGIHRSLGVHISKVRSATLDTWLPEQVAFIQSMGNERSNSYWEANLPPNYDRVGIENFIRAKYEDKRWVAKEGREIPPPAPIVQQQEEKAPVQWQRPAAKISLPVPPKEPEPVIPKAESALPSPPKHDFATDLFDMLSMDDEKLPEPSTDDLWAGFQSATVQQQPPPPTTTTTTTTTTTPTSGIEDLFKDSPPVPVATSQQPLPQK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037598`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037598

Location Chr09:15629420-15633712 (-)

Description Similar to AGD5: ADP-ribosylation factor GTPase-activating protein AGD5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g54310`	GTPase-activating protein (GAP) for ADP ribosylation factor (ARF).	AGD5 is a GTPase-activating protein at the trans-Golgi network.2010 · DOI: 10.1111/j.1365-313x.2010.04369.x
`At3g17660`	GTPase-activating protein (GAP) for ADP ribosylation factor (ARF).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037598 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0010227 floral organ abscission Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0030308 negative regulation of cell growth Biological Process

GO:0035652 clathrin-coated vesicle cargo loading Biological Process

GO:0050829 defense response to Gram-negative bacterium Biological Process

GO:0060866 leaf abscission Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005768 endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005802 trans-Golgi network Cellular Component

KEGG gene cross-reference

ath:AT3G17660

ath:AT5G54310

gga:419641

hsa:64744

mmu:69780

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.622

Rank 1 · LXL04_037598 · OH-1004

Golgi apparatus0.288

Rank 2 · LXL04_037598 · OH-1004

Cell membrane0.149

Rank 3 · LXL04_037598 · OH-1004

Nucleus0.112

Rank 4 · LXL04_037598 · OH-1004

Endoplasmic reticulum0.098

Rank 5 · LXL04_037598 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01412.24ArfGap17-125 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037598	`PF01412.24`	ArfGap	17	125	3.2e-42	144.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FL69`	Arabidopsis thaliana	ADP-ribosylation factor GTPase-activating protein AGD5	53.320%	Swiss-Prot	strong database homology
`Q0WQQ1`	Arabidopsis thaliana	Probable ADP-ribosylation factor GTPase-activating protein AGD15	69.065%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card