LXL04_037426 | RubberDandelionOmics

Gene overview

LXL04_037426

Reference: OH-1004 Chr: Chr09 Coordinates: 10754206-10757869 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

720 bp · LXL04_037426|LXL04_037426|OH1004|cDNA

ATGAACTTCTCCAAGAAATCGCCATCTCCTGCTCTCCTTTCTCTCAATCGCGATTTCTGGAAAAGGAACGAAGTTGCTTTCGTTGAGTCAGAACGTCTCATAGGCGATGGCGCCAAGAATCAAGCGGCAATGAACCCTGCTAACACCATTTTCGATGCCAAGAGATTGATCGGAAGAAGATTCACTGATTCCAAAGTACAGGATGACATGAAATTGTGGTCCTTTCGAGTCATACAAGCCCCTTCCGACACACCAAGAAT...

CDS

Download CDS FASTA

720 bp · LXL04_037426|LXL04_037426|OH1004|CDS

ATGAACTTCTCCAAGAAATCGCCATCTCCTGCTCTCCTTTCTCTCAATCGCGATTTCTGGAAAAGGAACGAAGTTGCTTTCGTTGAGTCAGAACGTCTCATAGGCGATGGCGCCAAGAATCAAGCGGCAATGAACCCTGCTAACACCATTTTCGATGCCAAGAGATTGATCGGAAGAAGATTCACTGATTCCAAAGTACAGGATGACATGAAATTGTGGTCCTTTCGAGTCATACAAGCCCCTTCCGACACACCAAGAAT...

Protein

Download Protein FASTA

239 aa · LXL04_037426|LXL04_037426|OH1004|PROTEIN

MNFSKKSPSPALLSLNRDFWKRNEVAFVESERLIGDGAKNQAAMNPANTIFDAKRLIGRRFTDSKVQDDMKLWSFRVIQAPSDTPRIVVSYKGQDKQFFPEEISSMILAKMKETADSYLGNFIHNTSEISSMILTKIFVGRRFTDSKVQDDMKLWSFRVIQAPSDTPRIVVSYKGQDKQFFLEEISSMILTKMKETADSYLGNFIHNTSEISSMILTKMLILLDLLTLIIQNSLQVEFK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_037426`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_037426

Location Chr09:10754206-10757869 (+)

Description Similar to HSC-2: Heat shock cognate 70 kDa protein 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g09440`	In cooperation with other chaperones, Hsp70s are key components that facilitate folding of de novo synthesized proteins, assist translocation of precursor proteins into organelles, and are responsible for degradation of damaged protein under stress conditions.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_037426 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006950 response to stress Biological Process

GO:0042026 protein refolding Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

GO:0031072 heat shock protein binding Molecular Function

GO:0044183 protein folding chaperone Molecular Function

KEGG gene cross-reference

sly:101247772

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.571

Rank 1 · LXL04_037426 · OH-1004

Nucleus0.276

Rank 2 · LXL04_037426 · OH-1004

Mitochondrion0.115

Rank 3 · LXL04_037426 · OH-1004

Cell membrane0.083

Rank 4 · LXL04_037426 · OH-1004

Endoplasmic reticulum0.062

Rank 5 · LXL04_037426 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00012.27HSP7025-125 aa

PF00012.27HSP70132-207 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_037426	`PF00012.27`	HSP70	25	125	3.2e-46	158.5
LXL04_037426	`PF00012.27`	HSP70	132	207	3.2e-46	158.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O65719`	Arabidopsis thaliana	Heat shock 70 kDa protein 3	67.647%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card