LXL04_036970 | RubberDandelionOmics

Gene overview

LXL04_036970

Reference: OH-1004 Chr: Chr08 Coordinates: 51025796-51028127 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

879 bp · LXL04_036970|LXL04_036970|OH1004|cDNA

ATGGCGATGTCGTCATTGTCATTGTCACCCGCTACTTCATCTGTGCGCTCGGTTTACCAACAGCCCAAATTAAACACTCCGAAATCACTCCTCTCTCTTCAAGGAAATTCGATGGCATGGAGCTCTTCAGCGAGTTATGTGAAACTTCAATCAAAGATTACTCTTGTTGTAAGAGCCTCTCCACAGAAGAGGCAAGTTAATTTGAAATTCGGCACTCAATTTATGCTTTTCTTACTTGTTGTACTTGTTTATCAAATCTG...

CDS

Download CDS FASTA

879 bp · LXL04_036970|LXL04_036970|OH1004|CDS

ATGGCGATGTCGTCATTGTCATTGTCACCCGCTACTTCATCTGTGCGCTCGGTTTACCAACAGCCCAAATTAAACACTCCGAAATCACTCCTCTCTCTTCAAGGAAATTCGATGGCATGGAGCTCTTCAGCGAGTTATGTGAAACTTCAATCAAAGATTACTCTTGTTGTAAGAGCCTCTCCACAGAAGAGGCAAGTTAATTTGAAATTCGGCACTCAATTTATGCTTTTCTTACTTGTTGTACTTGTTTATCAAATCTG...

Protein

Download Protein FASTA

292 aa · LXL04_036970|LXL04_036970|OH1004|PROTEIN

MAMSSLSLSPATSSVRSVYQQPKLNTPKSLLSLQGNSMAWSSSASYVKLQSKITLVVRASPQKRQVNLKFGTQFMLFLLVVLVYQIWIHEVTLSPIIKCATIEEIDAEKSLIEKNARDRMDKAIDSVLSNFNSIRTGRSNPAMLDKVEVEYYGSPVNLKTIAQISTPDSSSLLINPYDKSSLKSIEKAIVNSDLGLTPSNDGEVIRLSIPQLTSDRRKELSKIVAKQAEEGKVAIRNIRRDAIKSYDKLEKEKKLSEDNV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036970`
TK1151 ID	TkA04G013210
OH-1004 ID	LXL04_036970
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	95.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036970

Location Chr08:51025796-51028127 (-)

Description Similar to RRF: Ribosome-recycling factor, chloroplastic (Fragment)

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g63190`	Responsible for the release of ribosomes from messenger RNA at the termination of chloroplastic protein biosynthesis.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0570700`	Responsible for the release of ribosomes from messenger RNA at the termination of chloroplastic protein biosynthesis.	No verified direct reference in this release
`UniProt: A2YMU2`	Responsible for the release of ribosomes from messenger RNA at the termination of chloroplastic protein biosynthesis.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036970 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009658 chloroplast organization Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0032544 plastid translation Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009579 thylakoid Cellular Component

GO:0005507 copper ion binding Molecular Function

GO:0043023 ribosomal large subunit binding Molecular Function

KEGG gene cross-reference

ath:AT3G63190

dosa:Os07g0570700

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.978

Rank 1 · LXL04_036970 · OH-1004

Mitochondrion0.039

Rank 2 · LXL04_036970 · OH-1004

Cytoplasm0.017

Rank 3 · LXL04_036970 · OH-1004

Peroxisome0.013

Rank 4 · LXL04_036970 · OH-1004

Nucleus0.010

Rank 5 · LXL04_036970 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01765.25RRF130-290 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036970	`PF01765.25`	RRF	130	290	1.1e-64	218.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M1X0`	Arabidopsis thaliana	Ribosome-recycling factor, chloroplastic	60.204%	Swiss-Prot	strong database homology
`A3BLC3`	Oryza sativa subsp. japonica	Ribosome-recycling factor, chloroplastic	76.650%	Swiss-Prot	moderate database homology
`A2YMU2`	Oryza sativa subsp. indica	Ribosome-recycling factor, chloroplastic	76.650%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card