Gene Card
Gene overview
cDNA / CDS / Protein Sequences
5475 bp · LXL04_036178|LXL04_036178|OH1004|cDNA
ATGGCTAGAAAATCCAAAAAGTCTAAACAAGCAGTTGAAGAAGAACGGGTAATGGAGCCTGAAAACCTTGACGACGAAGACGACGACCAGTTTGAGGATGACGGTTTCATAGTGCAAGATGTTGATGAAGATGAGGGCGGTGAGGACAGTGATGATGGTAAGCAAAAGAAGAGGATGAAAAAGAGAAGAGATTTAAAAAAGACTTGTGTTCTTGATGAGGATGACTATGAACTCCTTCAAGAGAACATCCCTGGCTTTCA...
5475 bp · LXL04_036178|LXL04_036178|OH1004|CDS
ATGGCTAGAAAATCCAAAAAGTCTAAACAAGCAGTTGAAGAAGAACGGGTAATGGAGCCTGAAAACCTTGACGACGAAGACGACGACCAGTTTGAGGATGACGGTTTCATAGTGCAAGATGTTGATGAAGATGAGGGCGGTGAGGACAGTGATGATGGTAAGCAAAAGAAGAGGATGAAAAAGAGAAGAGATTTAAAAAAGACTTGTGTTCTTGATGAGGATGACTATGAACTCCTTCAAGAGAACATCCCTGGCTTTCA...
Protein
Download Protein FASTA1824 aa · LXL04_036178|LXL04_036178|OH1004|PROTEIN
MARKSKKSKQAVEEERVMEPENLDDEDDDQFEDDGFIVQDVDEDEGGEDSDDGKQKKRMKKRRDLKKTCVLDEDDYELLQENIPGFQRPKLESENFKRLKKARTDGDEGPSGFYGGEEYDNSGIAKEKLTRTLFGEDEGKNRKYTKFFLRYFQICPQFLGLFVDDSSKELLDEEKDDMLSEDEMADFIVEEVETVEPAASSRSVKANKKKTKKSVGVSSSSRQSQNDIFGGLDDFYKLAPENISKYSDTNELKAKKVEDE...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_036178 |
|---|---|
| TK1151 ID | TkA04G067520 |
| OH-1004 ID | LXL04_036178 |
| Relationship / confidence | Rbh Sequence Supported / Probable |
| Protein identity (%) | 97.600 |
| Protein coverage (%) | TK1151 99.437 / OH-1004 79.002Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_036178 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr08:37582406-37588833 (-) | |||||||||
| Description | Similar to SPT6: Transcription elongation factor SPT6 homolog | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006368 transcription elongation by RNA polymerase II Biological Process GO:0006397 mRNA processing Biological Process GO:0008380 RNA splicing Biological Process GO:0009793 embryo development ending in seed dormancy Biological Process GO:0034728 nucleosome organization Biological Process GO:0051028 mRNA transport Biological Process GO:0140673 transcription elongation-coupled chromatin remodeling Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0008023 transcription elongation factor complex Cellular Component GO:0009506 plasmodesma Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT1G63210 ath:AT1G65440 dre:337866 hsa:6830 mmu:20926 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF14632.12SPT6_acidic21-104 aaPF14641.12HTH_44305-430 aaPF22706.2Tex_central_region538-707 aaPF14639.12YqgF739-887 aaPF14635.13HHH_7891-991 aaPF17674.8HHH_91006-1027 aaPF21710.4Spt6_S11109-1195 aaPF14633.13SH2_21228-1426 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_036178 | PF14632.12 | SPT6_acidic | 21 | 104 | 2e-12 | 48.0 |
| LXL04_036178 | PF14641.12 | HTH_44 | 305 | 430 | 6.5e-07 | 30.5 |
| LXL04_036178 | PF22706.2 | Tex_central_region | 538 | 707 | 5.5e-06 | 27.2 |
| LXL04_036178 | PF14639.12 | YqgF | 739 | 887 | 3.2e-17 | 63.5 |
| LXL04_036178 | PF14635.13 | HHH_7 | 891 | 991 | 1.5e-17 | 64.6 |
| LXL04_036178 | PF17674.8 | HHH_9 | 1006 | 1027 | 2.8e-06 | 28.8 |
| LXL04_036178 | PF21710.4 | Spt6_S1 | 1109 | 1195 | 1.9e-10 | 41.6 |
| LXL04_036178 | PF14633.13 | SH2_2 | 1228 | 1426 | 1.2e-61 | 208.5 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.