LXL04_035513 | RubberDandelionOmics

Gene overview

LXL04_035513

Reference: OH-1004 Chr: Chr08 Coordinates: 23826587-23830774 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1932 bp · LXL04_035513|LXL04_035513|OH1004|cDNA

atGGCAGCATCCATGAACAACTGGTTAGGGTTCTCACTCTCACCTCAAGATCAACAACATATGGATGCTTCACAGACATCTATTGTTGATAACTTCAACTCTGAGGACATTTCCGGCACCGGTGAATGCTTTGATCTTGGTTCCACCGCCAGTCACTCCACCATACCTTCTCTCAACCTCCATCCTCCGTATGGCATACTGGAACCCTACCATAATCACCATGATTGGAACATGAAAGAGAGCTCGGAGCTGTCGGTTTT...

CDS

Download CDS FASTA

1932 bp · LXL04_035513|LXL04_035513|OH1004|CDS

ATGGCAGCATCCATGAACAACTGGTTAGGGTTCTCACTCTCACCTCAAGATCAACAACATATGGATGCTTCACAGACATCTATTGTTGATAACTTCAACTCTGAGGACATTTCCGGCACCGGTGAATGCTTTGATCTTGGTTCCACCGCCAGTCACTCCACCATACCTTCTCTCAACCTCCATCCTCCGTATGGCATACTGGAACCCTACCATAATCACCATGATTGGAACATGAAAGAGAGCTCGGAGCTGTCGGTTTT...

Protein

Download Protein FASTA

643 aa · LXL04_035513|LXL04_035513|OH1004|PROTEIN

MAASMNNWLGFSLSPQDQQHMDASQTSIVDNFNSEDISGTGECFDLGSTASHSTIPSLNLHPPYGILEPYHNHHDWNMKESSELSVLMAGGGSCNGENPEIQPPKFENFLSVGNGGDYMYSTMQLPPQAAVTEVTTTTHDTTRGNNNMTSSSTIGLSMIKNWLRNNPTPSNQNTTTTTRQENDNGTGTAVTGGFTGGGRSNELSLSMSTGGNSTGGFVAISGGADSSSSDNKRQQMEVATTVDSENGGGVTTEAVPRKSI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035513`
TK1151 ID	TkA04G125800
OH-1004 ID	LXL04_035513
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	86.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035513

Location Chr08:23826587-23830774 (+)

Description Similar to BBM: AP2-like ethylene-responsive transcription factor BBM

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g17430`	Transcription factor that, in opposition to HDG1, promotes cell proliferation and morphogenesis via transcriptional activation of meristem and cell proliferation genes, but prevents differentiation, especially during embryogenesis.	No verified direct reference in this release
`At3g20840`	Probably acts as a transcriptional activator.	No verified direct reference in this release
`At5g57390`	Probably acts as a transcriptional activator.	AINTEGUMENTA-like (AIL) genes are expressed in young tissues and may specify meristematic or division-competent states.2005 · DOI: 10.1007/s11103-005-0955-6

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035513 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000723 telomere maintenance Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0007389 pattern specification process Biological Process

GO:0008283 cell population proliferation Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0009845 seed germination Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0010311 lateral root formation Biological Process

GO:0010449 root meristem growth Biological Process

KEGG gene cross-reference

ath:AT3G20840

ath:AT5G17430

ath:AT5G57390

bna:106385624

bna:106426170

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.971

Rank 1 · LXL04_035513 · OH-1004

Cytoplasm0.075

Rank 2 · LXL04_035513 · OH-1004

Cell membrane0.032

Rank 3 · LXL04_035513 · OH-1004

Endoplasmic reticulum0.028

Rank 4 · LXL04_035513 · OH-1004

Plastid0.017

Rank 5 · LXL04_035513 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00847.27AP2270-324 aa

PF00847.27AP2369-418 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035513	`PF00847.27`	AP2	270	324	3.1e-18	66.5
LXL04_035513	`PF00847.27`	AP2	369	418	3.1e-18	66.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6PQQ4`	Arabidopsis thaliana	AP2-like ethylene-responsive transcription factor BBM	45.255%	Swiss-Prot	moderate database homology
`Q5YGP8`	Arabidopsis thaliana	AP2-like ethylene-responsive transcription factor PLT1	58.689%	Swiss-Prot	moderate database homology
`Q6PQQ3`	Arabidopsis thaliana	AP2-like ethylene-responsive transcription factor AIL5	69.231%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card