LXL04_035167 | RubberDandelionOmics

Gene overview

LXL04_035167

Reference: OH-1004 Chr: Chr08 Coordinates: 16098065-16099179 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1038 bp · LXL04_035167|LXL04_035167|OH1004|cDNA

ATGATGGCGTCACCCCGGGAATTTTTTGATATTTCAGGACCTCTCCACCTGCTAACTTCTTTCGACTGGAGAAACACGTTTCATCGGAGATCCCTTGCTGCGAGCCTTGTTCGAGGTGTTTACATTTTGGAAAAGGACCGTCAACGTGGAAGCATTGGGCAAGATGCTAATGCTCCTCCATGGTGGGAACGATTTCACTTTCAGTTAAATCGCGTTCTAGTAGACGATAGTGATTTATCCTACTTCGGGGCCATTTTTGA...

CDS

Download CDS FASTA

1038 bp · LXL04_035167|LXL04_035167|OH1004|CDS

ATGATGGCGTCACCCCGGGAATTTTTTGATATTTCAGGACCTCTCCACCTGCTAACTTCTTTCGACTGGAGAAACACGTTTCATCGGAGATCCCTTGCTGCGAGCCTTGTTCGAGGTGTTTACATTTTGGAAAAGGACCGTCAACGTGGAAGCATTGGGCAAGATGCTAATGCTCCTCCATGGTGGGAACGATTTCACTTTCAGTTAAATCGCGTTCTAGTAGACGATAGTGATTTATCCTACTTCGGGGCCATTTTTGA...

Protein

Download Protein FASTA

345 aa · LXL04_035167|LXL04_035167|OH1004|PROTEIN

MMASPREFFDISGPLHLLTSFDWRNTFHRRSLAASLVRGVYILEKDRQRGSIGQDANAPPWWERFHFQLNRVLVDDSDLSYFGAIFELKYAHPIFFQTSPYPPRYIIAFRGTISRSVTRSEDMKLNMKCIFDKLEESSRFHTAFEAVWNTVAMVGPMNVWIAGHSLGAAIAMLAGRNMAKSRYQLETYLFNPPFITVPIEKMIKNETLKHVVRIAGSLLKAGIATTMNLRPEDPEEDPFIVLSDWTPYVFVNRSDPICAE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035167`
TK1151 ID	TkA04G161180
OH-1004 ID	LXL04_035167
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	95.500
Protein coverage (%)	TK1151 100.000 / OH-1004 64.638 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035167

Location Chr08:16098065-16099179 (-)

Description Similar to At4g10955: GDSL esterase/lipase At4g10955

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g10955`	GDSL esterase/lipase At4g10955.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035167 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0016042 lipid catabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0016787 hydrolase activity Molecular Function

KEGG gene cross-reference

ath:AT4G10955

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.429

Rank 1 · LXL04_035167 · OH-1004

Cytoplasm0.336

Rank 2 · LXL04_035167 · OH-1004

Nucleus0.131

Rank 3 · LXL04_035167 · OH-1004

Cell membrane0.096

Rank 4 · LXL04_035167 · OH-1004

Mitochondrion0.092

Rank 5 · LXL04_035167 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01764.32Lipase_3155-188 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035167	`PF01764.32`	Lipase_3	155	188	6.3e-06	26.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q680C0`	Arabidopsis thaliana	GDSL esterase/lipase At4g10955	45.787%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card