LXL04_035031 | RubberDandelionOmics

Gene overview

LXL04_035031

Reference: OH-1004 Chr: Chr08 Coordinates: 11605953-11607110 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1158 bp · LXL04_035031|LXL04_035031|OH1004|cDNA

atgGATGAAGAAGATAACACCCGACCGGAACACATTCCACATGAACTAGTGTCCGAAATACTCACACGCCTCGACGTCAAATCATTGACCCGATTCCGCTCCGTTTCTACCCGATGGAACTCCACCATTGTCCATCCATCTTTCTCCAAATCCCACCTCTGTCACTCCCCCACCGGCGCCGGAGCTCCTGTTACACTCGTCCTCTCCTTCATCAACCGCTTCAATTCCGAGCGCACCGTCTTCTCCGTCAAGATTCTGCC...

CDS

Download CDS FASTA

1158 bp · LXL04_035031|LXL04_035031|OH1004|CDS

ATGGATGAAGAAGATAACACCCGACCGGAACACATTCCACATGAACTAGTGTCCGAAATACTCACACGCCTCGACGTCAAATCATTGACCCGATTCCGCTCCGTTTCTACCCGATGGAACTCCACCATTGTCCATCCATCTTTCTCCAAATCCCACCTCTGTCACTCCCCCACCGGCGCCGGAGCTCCTGTTACACTCGTCCTCTCCTTCATCAACCGCTTCAATTCCGAGCGCACCGTCTTCTCCGTCAAGATTCTGCC...

Protein

Download Protein FASTA

385 aa · LXL04_035031|LXL04_035031|OH1004|PROTEIN

MDEEDNTRPEHIPHELVSEILTRLDVKSLTRFRSVSTRWNSTIVHPSFSKSHLCHSPTGAGAPVTLVLSFINRFNSERTVFSVKILPNQTTSLPNPTHVLTIPGFAHPFVSQSLNGLICFNLGAMCVCNPSTRKFLKLPWSKTEIPPPSPASTHHRRNAFGFDPVSNAHKVLDTWITCHENEMVMEHKIFTVGSGCNKWKRIADGPPYFPFNESVCINGQIYFRAFTSVTDSEETVMVAFDVNREEFRFIQMRDDAISNS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035031`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035031

Location Chr08:11605953-11607110 (+)

Description Similar to At1g30790: F-box protein At1g30790

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g30790`	F-box protein At1g30790.	No verified direct reference in this release
`At5g62510`	F-box protein At5g62510.	No verified direct reference in this release
`At1g47790`	Putative F-box protein At1g47790.	No verified direct reference in this release
`At3g57590`	F-box protein At3g57590.	No verified direct reference in this release
`At2g31470`	Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035031 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009414 response to water deprivation Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process

GO:0010118 stomatal movement Biological Process

GO:0010119 regulation of stomatal movement Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0042631 cellular response to water deprivation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT1G30790

ath:AT1G47790

ath:AT2G31470

ath:AT3G57590

ath:AT5G62510

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.616

Rank 1 · LXL04_035031 · OH-1004

Nucleus0.419

Rank 2 · LXL04_035031 · OH-1004

Cell membrane0.124

Rank 3 · LXL04_035031 · OH-1004

Endoplasmic reticulum0.074

Rank 4 · LXL04_035031 · OH-1004

Lysosome / Vacuole0.026

Rank 5 · LXL04_035031 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646.39F-box11-48 aa

PF12937.13F-box-like11-48 aa

PF08268.18FBA_375-367 aa

PF07734.19FBA_1115-296 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035031	`PF00646.39`	F-box	11	48	7.5e-10	39.0
LXL04_035031	`PF12937.13`	F-box-like	11	48	1.6e-07	31.7
LXL04_035031	`PF08268.18`	FBA_3	75	367	2e-63	215.0
LXL04_035031	`PF07734.19`	FBA_1	115	296	1e-12	48.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SY20`	Arabidopsis thaliana	F-box protein At1g30790	30.170%	Swiss-Prot	moderate database homology
`Q9FJJ4`	Arabidopsis thaliana	F-box protein At5g62510	31.099%	Swiss-Prot	moderate database homology
`Q9FZF8`	Arabidopsis thaliana	Putative F-box protein At1g47790	29.235%	Swiss-Prot	weak database homology
`Q9SVX4`	Arabidopsis thaliana	F-box protein At3g57590	27.919%	Swiss-Prot	weak database homology
`Q5BPS3`	Arabidopsis thaliana	F-box protein DOR	27.792%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card