LXL04_034540 | RubberDandelionOmics

Gene overview

LXL04_034540

Reference: OH-1004 Chr: Chr07 Coordinates: 104822279-104824659 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

867 bp · LXL04_034540|LXL04_034540|OH1004|cDNA

ATGCTCTTCCTGTTGAGAAAGGTACCATCGCTATCAATCACAATTACATCACCGCCATCCTACTCTGCTTCTCTTTCTAGGCTCAAGAACATGGCATCGATCAACAACAGCAACGGGATTTCGTCGAAGTTGGCTGTATTAGCTCAGCAGCTCCGCCTTTACAAGCCGCCGCCAGGTGATGCTGACGATGATGACGAAGTCGTTTCTCAAGTGGGTTTTGCAGAATCTGCAAGCCGAATTAGTAATCAGGCGTCCGAAAG...

CDS

Download CDS FASTA

867 bp · LXL04_034540|LXL04_034540|OH1004|CDS

ATGCTCTTCCTGTTGAGAAAGGTACCATCGCTATCAATCACAATTACATCACCGCCATCCTACTCTGCTTCTCTTTCTAGGCTCAAGAACATGGCATCGATCAACAACAGCAACGGGATTTCGTCGAAGTTGGCTGTATTAGCTCAGCAGCTCCGCCTTTACAAGCCGCCGCCAGGTGATGCTGACGATGATGACGAAGTCGTTTCTCAAGTGGGTTTTGCAGAATCTGCAAGCCGAATTAGTAATCAGGCGTCCGAAAG...

Protein

Download Protein FASTA

288 aa · LXL04_034540|LXL04_034540|OH1004|PROTEIN

MLFLLRKVPSLSITITSPPSYSASLSRLKNMASINNSNGISSKLAVLAQQLRLYKPPPGDADDDDEVVSQVGFAESASRISNQASERFRPKRAAVLICLFEGNNDGSGDGLRVILTKRSSTLSTHSGEVSLPGGKAEEDDVDDAYTAKREANEEIGLDPSLVNVVAILEPFLSKHLLRVIPVIGILSDRSAFNPTPNVDEVDDVFDAPLEMFLKDENRRSEEREWMGDTYLIHYFNYEINGKSYLIWGLTAGILIRAASI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_034540`
TK1151 ID	TkA08G402210
OH-1004 ID	LXL04_034540
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_034540

Location Chr07:104822279-104824659 (-)

Description Similar to NUDT15: Nudix hydrolase 15, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g28960`	Coenzyme A diphosphatase which mediates the cleavage of oxidized CoA.	No verified direct reference in this release
`At2g33980`	Probably mediates the hydrolysis of some nucleoside diphosphate derivatives.	No verified direct reference in this release
`At5g45940`	Coenzyme A diphosphatase which mediates the cleavage of CoA into 3',5'-ADP from CoA and 4'-phosphopantetheine.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034540 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006104 succinyl-CoA metabolic process Biological Process

GO:0006637 acyl-CoA metabolic process Biological Process

GO:0006753 nucleoside phosphate metabolic process Biological Process

GO:0009132 nucleoside diphosphate metabolic process Biological Process

GO:0015937 coenzyme A biosynthetic process Biological Process

GO:0015938 coenzyme A catabolic process Biological Process

GO:0036114 medium-chain fatty-acyl-CoA catabolic process Biological Process

GO:0044580 butyryl-CoA catabolic process Biological Process

GO:0046356 acetyl-CoA catabolic process Biological Process

GO:1901289 succinyl-CoA catabolic process Biological Process

GO:1902858 propionyl-CoA metabolic process Biological Process

GO:1902859 propionyl-CoA catabolic process Biological Process

KEGG gene cross-reference

ath:AT1G28960

ath:AT2G33980

ath:AT5G45940

hsa:283927

mmu:67528

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.667

Rank 1 · LXL04_034540 · OH-1004

Mitochondrion0.300

Rank 2 · LXL04_034540 · OH-1004

Cytoplasm0.093

Rank 3 · LXL04_034540 · OH-1004

Nucleus0.057

Rank 4 · LXL04_034540 · OH-1004

Peroxisome0.048

Rank 5 · LXL04_034540 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00293.35NUDIX91-211 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_034540	`PF00293.35`	NUDIX	91	211	2.9e-11	44.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GYB1`	Arabidopsis thaliana	Nudix hydrolase 15, mitochondrial	64.948%	Swiss-Prot	strong database homology
`O22951`	Arabidopsis thaliana	Nudix hydrolase 22, chloroplastic	65.182%	Swiss-Prot	strong database homology
`Q8LET2`	Arabidopsis thaliana	Nudix hydrolase 11	57.292%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card