LXL04_033423 | RubberDandelionOmics

Gene overview

LXL04_033423

Reference: OH-1004 Chr: Chr07 Coordinates: 43451513-43453412 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1443 bp · LXL04_033423|LXL04_033423|OH1004|cDNA

ATGGATGACCTTCAAGCAACCTACAAAGAAGACCCTGACGAAGATAATGCCAACACACATAACAACAACGGCGACGTTAATTCAGAAATGGCGGATCCAAAACCAGAAATTGTCACTTCCACCACCGCCATCACAATCGTCGACGAAGCACTTACCGttcccaccaccaccaccgtcgACGAAGCCGTAGCTGTTGTCACAACGACCACTATTACCACCACATCAACCACCTCCGCAACCCCCGAGACCGATTCCGGCAC...

CDS

Download CDS FASTA

1443 bp · LXL04_033423|LXL04_033423|OH1004|CDS

ATGGATGACCTTCAAGCAACCTACAAAGAAGACCCTGACGAAGATAATGCCAACACACATAACAACAACGGCGACGTTAATTCAGAAATGGCGGATCCAAAACCAGAAATTGTCACTTCCACCACCGCCATCACAATCGTCGACGAAGCACTTACCGTTCCCACCACCACCACCGTCGACGAAGCCGTAGCTGTTGTCACAACGACCACTATTACCACCACATCAACCACCTCCGCAACCCCCGAGACCGATTCCGGCAC...

Protein

Download Protein FASTA

480 aa · LXL04_033423|LXL04_033423|OH1004|PROTEIN

MDDLQATYKEDPDEDNANTHNNNGDVNSEMADPKPEIVTSTTAITIVDEALTVPTTTTVDEAVAVVTTTTITTTSTTSATPETDSGTKDDPMPSEELSDLEPTPKDSPNFTKVISSEDEMEEHEERPTKKHKNLSLLAQPIEEELSLEIAATPISSMPPPTEKPSGKKSTSSMKKKKSKGNNVWTKPSSRKGKKRTKSTTSTTAQTEDSVLITPIHRYPDKNDDAEDMKICLSKVYKAEKVELSEDRLTAGSCKGYRMVR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_033423`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_033423

Location Chr07:43451513-43453412 (+)

Description Similar to TRO: Protein TRAUCO

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g51450`	Trithorax-group gene homolog required for early embryogenesis.	Arabidopsis COMPASS-like complexes mediate histone H3 lysine-4 trimethylation to control floral transition and plant development.2011 · DOI: 10.1371/journal.pgen.1001330

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_033423 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006325 chromatin organization Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0006974 DNA damage response Biological Process

GO:0008284 positive regulation of cell population proliferation Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

GO:0010557 positive regulation of macromolecule biosynthetic process Biological Process

GO:0010628 positive regulation of gene expression Biological Process

GO:0010629 negative regulation of gene expression Biological Process

GO:0032968 positive regulation of transcription elongation by RNA polymerase II Biological Process

KEGG gene cross-reference

ath:AT1G51450

dme:Dmel_CG6677

hsa:9070

mmu:23808

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.902

Rank 1 · LXL04_033423 · OH-1004

Cytoplasm0.164

Rank 2 · LXL04_033423 · OH-1004

Cell membrane0.042

Rank 3 · LXL04_033423 · OH-1004

Endoplasmic reticulum0.021

Rank 4 · LXL04_033423 · OH-1004

Mitochondrion0.015

Rank 5 · LXL04_033423 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00622.37SPRY270-345 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_033423	`PF00622.37`	SPRY	270	345	6.3e-14	52.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C8J7`	Arabidopsis thaliana	Protein TRAUCO	75.269%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card