LXL04_032945 | RubberDandelionOmics

Gene overview

LXL04_032945

Reference: OH-1004 Chr: Chr07 Coordinates: 32045110-32050248 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2247 bp · LXL04_032945|LXL04_032945|OH1004|cDNA

ATGAAATCAACAAGACTTTTGGGTCTTCTTATGCTTGTAACACTTGCATTTGGCCATGGAGCCGATGATAGACAGCATTACATTGTCTACATGGGACAACACTCCCATCCAAGCTCCAAGTCTGTCGTCTCTGCTAACCATGAAATGCTCACATCGGTTCTTGAAAGTTATAGTGGAGCAAAAGAAGCAACAATCCATCATTACACTAAAAGCTTCAGAGGCTTTTCCGCCATGCTTACACCTGATCAAGCTACAAGACT...

CDS

Download CDS FASTA

2247 bp · LXL04_032945|LXL04_032945|OH1004|CDS

ATGAAATCAACAAGACTTTTGGGTCTTCTTATGCTTGTAACACTTGCATTTGGCCATGGAGCCGATGATAGACAGCATTACATTGTCTACATGGGACAACACTCCCATCCAAGCTCCAAGTCTGTCGTCTCTGCTAACCATGAAATGCTCACATCGGTTCTTGAAAGTTATAGTGGAGCAAAAGAAGCAACAATCCATCATTACACTAAAAGCTTCAGAGGCTTTTCCGCCATGCTTACACCTGATCAAGCTACAAGACT...

Protein

Download Protein FASTA

748 aa · LXL04_032945|LXL04_032945|OH1004|PROTEIN

MKSTRLLGLLMLVTLAFGHGADDRQHYIVYMGQHSHPSSKSVVSANHEMLTSVLESYSGAKEATIHHYTKSFRGFSAMLTPDQATRLSEKEAVVSVFKSRLNHLHTTKSWRFLGVDSIPEYNKLPMDIKSDVIVGVIDSGFWPESESFNDYGLGPVPIKFKGECVPGQNFTKSNCNRYYSKGFEATNGPLEKFNRTFFRSPRDTDGHGTHTSSTIAGSRVSNVSLHGLASGTATGGVPSARLSIYKACWFNGCEDADLLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032945`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032945

Location Chr07:32045110-32050248 (+)

Description Similar to SbtS: Subtilisin-like serine-protease S

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g67360`	Serine protease.	Ara12 subtilisin-like protease from Arabidopsis thaliana: purification, substrate specificity and tissue localization.2003 · DOI: 10.1042/bj20021125 A subtilisin-like serine protease essential for mucilage release from Arabidopsis seed coats.2008 · DOI: 10.1111/j.1365-313x.2008.03437.x
`At2g04160`	Serine protease.	No verified direct reference in this release
`At4g34980`	Subtilisin-like protease SBT1.6.	No verified direct reference in this release
`At1g20160`	May cleave EPF2 peptide and participate in CO₂-regulated stomatal development.	Carbonic anhydrases, EPF2 and a novel protease mediate CO2 control of stomatal development.2014 · DOI: 10.1038/nature13452

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032945 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009609 response to symbiotic bacterium Biological Process

GO:0009610 response to symbiotic fungus Biological Process

GO:0009733 response to auxin Biological Process

GO:0009827 plant-type cell wall modification Biological Process

GO:0010037 response to carbon dioxide Biological Process

GO:0010102 lateral root morphogenesis Biological Process

GO:0010214 seed coat development Biological Process

GO:0036377 arbuscular mycorrhizal association Biological Process

GO:0080001 mucilage extrusion from seed coat Biological Process

GO:1900425 negative regulation of defense response to bacterium Biological Process

GO:2000038 regulation of stomatal complex development Biological Process

KEGG gene cross-reference

ath:AT1G20160

ath:AT2G04160

ath:AT4G34980

ath:AT5G67360

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.622

Rank 1 · LXL04_032945 · OH-1004

Lysosome / Vacuole0.137

Rank 2 · LXL04_032945 · OH-1004

Cytoplasm0.085

Rank 3 · LXL04_032945 · OH-1004

Cell membrane0.070

Rank 4 · LXL04_032945 · OH-1004

Endoplasmic reticulum0.063

Rank 5 · LXL04_032945 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05922.22Inhibitor_I927-105 aa

PF00082.28Peptidase_S8130-573 aa

PF17766.8fn3_6650-743 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032945	`PF05922.22`	Inhibitor_I9	27	105	3.8e-15	57.0
LXL04_032945	`PF00082.28`	Peptidase_S8	130	573	2.9e-44	152.2
LXL04_032945	`PF17766.8`	fn3_6	650	743	3.8e-21	75.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O65351`	Arabidopsis thaliana	Subtilisin-like protease SBT1.7	42.373%	Swiss-Prot	moderate database homology
`Q9ZSP5`	Arabidopsis thaliana	Subtilisin-like protease SBT5.3	42.857%	Swiss-Prot	moderate database homology
`O49607`	Arabidopsis thaliana	Subtilisin-like protease SBT1.6	42.936%	Swiss-Prot	moderate database homology
`Q9LNU1`	Arabidopsis thaliana	CO(2)-response secreted protease	40.576%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card