LXL04_032084 | RubberDandelionOmics

Gene overview

LXL04_032084

Reference: OH-1004 Chr: Chr07 Coordinates: 16538179-16539224 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

852 bp · LXL04_032084|LXL04_032084|OH1004|cDNA

ATGTCAATGGCTCTCAGCTTCTACAGCAACTGGTCAAGTCATGACGCCGCCTACTCTTCTATTCTCCGGCCACCGTCACCACCACCGGAGCTGTTCACTTTCCATGAAGACTATACATTGTACGATAACCCACTTTTTGACCCTAACTACAGCAACAATGTAGAGGTAATTGAAATTCCCAGTTTAGAGTCGCCAAATTATTTCGATAATTTCCCACCAGGAATATCCACCGGAAATATCTTTGCTCCGTCGCCGGAACT...

CDS

Download CDS FASTA

852 bp · LXL04_032084|LXL04_032084|OH1004|CDS

ATGTCAATGGCTCTCAGCTTCTACAGCAACTGGTCAAGTCATGACGCCGCCTACTCTTCTATTCTCCGGCCACCGTCACCACCACCGGAGCTGTTCACTTTCCATGAAGACTATACATTGTACGATAACCCACTTTTTGACCCTAACTACAGCAACAATGTAGAGGTAATTGAAATTCCCAGTTTAGAGTCGCCAAATTATTTCGATAATTTCCCACCAGGAATATCCACCGGAAATATCTTTGCTCCGTCGCCGGAACT...

Protein

Download Protein FASTA

283 aa · LXL04_032084|LXL04_032084|OH1004|PROTEIN

MSMALSFYSNWSSHDAAYSSILRPPSPPPELFTFHEDYTLYDNPLFDPNYSNNVEVIEIPSLESPNYFDNFPPGISTGNIFAPSPELHGSSYTYQAPYYNIPNSATFNHEHLSQFYTECTLTPELPSELPQLPEIYQGVGCAATLPPWSGSGRRNFIDEVEESCNVQLKRQNVGNGRGCLSAQSMAARVRRRKISEKTQELGKLIPGGHKMNTAEMFQAAFKYIKFLQAQIGVLKLMTSIPETEEALGDGEMQALMTCTL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032084`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032084

Location Chr07:16538179-16539224 (-)

Description Similar to BHLH52: Transcription factor bHLH52

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g30670`	Transcription factor bHLH52.	No verified direct reference in this release
`At2g34820`	Transcription factor bHLH53.	No verified direct reference in this release
`At3g21330`	Transcription factor bHLH87.	No verified direct reference in this release
`At4g00120`	Transcription regulator required for seed dispersal.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0541400`	Transcription factor involved in the negative regulation of flowering.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032084 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0009555 pollen development Biological Process

GO:0010197 polar nucleus fusion Biological Process

GO:0022619 generative cell differentiation Biological Process

GO:0048586 regulation of long-day photoperiodism, flowering Biological Process

GO:0048587 regulation of short-day photoperiodism, flowering Biological Process

GO:0055046 microgametogenesis Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G30670

ath:AT2G34820

ath:AT3G21330

ath:AT4G00120

dosa:Os05g0541400

osa:9269440

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.973

Rank 1 · LXL04_032084 · OH-1004

Cytoplasm0.107

Rank 2 · LXL04_032084 · OH-1004

Cell membrane0.024

Rank 3 · LXL04_032084 · OH-1004

Endoplasmic reticulum0.022

Rank 4 · LXL04_032084 · OH-1004

Plastid0.013

Rank 5 · LXL04_032084 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SA82`	Arabidopsis thaliana	Transcription factor bHLH52	61.856%	Swiss-Prot	weak database homology
`Q84RD0`	Arabidopsis thaliana	Transcription factor bHLH53	51.538%	Swiss-Prot	weak database homology
`Q8S3D2`	Arabidopsis thaliana	Transcription factor bHLH87	47.761%	Swiss-Prot	weak database homology
`O81313`	Arabidopsis thaliana	Transcription factor IND	43.750%	Swiss-Prot	weak database homology
`A0A0P0WQ90`	Oryza sativa subsp. japonica	Transcription factor LATE FLOWERING	47.170%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card