LXL04_027698 | RubberDandelionOmics

Gene overview

LXL04_027698

Reference: OH-1004 Chr: Chr06 Coordinates: 22000239-22004525 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1737 bp · LXL04_027698|LXL04_027698|OH1004|cDNA

ATGACGATTCACTCGGCTGTTATTCAGAAGCTTCTAAGCACAAATGCTCACTTAGGTCGTCGAGCAGCTGAGAACCATTTCAAAATCTACACTTATGGCGCTCGAAATGGAATGACGATTATCGACTCCGACAAAACCCTTGTTTGCCTCCGTAGCGCCTGCAATTTCATTGGGAATCTTGTTCGCGAAAACGGTAGGTTTCTGTTCGTGAATACCAATCCATTAGTCGATGAAATCGTTGAGCAGATGATTAAAAGCAC...

CDS

Download CDS FASTA

1737 bp · LXL04_027698|LXL04_027698|OH1004|CDS

ATGACGATTCACTCGGCTGTTATTCAGAAGCTTCTAAGCACAAATGCTCACTTAGGTCGTCGAGCAGCTGAGAACCATTTCAAAATCTACACTTATGGCGCTCGAAATGGAATGACGATTATCGACTCCGACAAAACCCTTGTTTGCCTCCGTAGCGCCTGCAATTTCATTGGGAATCTTGTTCGCGAAAACGGTAGGTTTCTGTTCGTGAATACCAATCCATTAGTCGATGAAATCGTTGAGCAGATGATTAAAAGCAC...

Protein

Download Protein FASTA

578 aa · LXL04_027698|LXL04_027698|OH1004|PROTEIN

MTIHSAVIQKLLSTNAHLGRRAAENHFKIYTYGARNGMTIIDSDKTLVCLRSACNFIGNLVRENGRFLFVNTNPLVDEIVEQMIKSTGCRNDNSWRLGGFLTNSLSPKKFRSRNKKLNLTSVYPPDCVVIFDTERKSSVILEASRLQIPIVGLALLFTSSISHYMLVDPSMPLETYKKITYPVPANDSVEFVYLFCNLITKTIQYEQKKLAAAKGKGAKEEEMKIGEAVQQIENIKSEGTDDELFILPYESLLPVSDDPL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027698`
TK1151 ID	TkA07G086620
OH-1004 ID	LXL04_027698
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027698

Location Chr06:22000239-22004525 (-)

Description Similar to UGPA: UTP--glucose-1-phosphate uridylyltransferase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g17310`	Converts glucose 1-phosphate to UDP-glucose, which is the major glycosyl donor for polysaccharides.	UDP-glucose pyrophosphorylase is not rate limiting, but is essential in Arabidopsis.2009 · DOI: 10.1093/pcp/pcp052 UDP-glucose pyrophosphorylase is rate limiting in vegetative and reproductive phases in Arabidopsis thaliana.2010 · DOI: 10.1093/pcp/pcq057 UDP-glucose pyrophosphorylase is a novel plant cell death regulator.2013 · DOI: 10.1021/pr3010887

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027698 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005977 glycogen metabolic process Biological Process

GO:0006011 UDP-alpha-D-glucose metabolic process Biological Process

GO:0009555 pollen development Biological Process

GO:0052543 callose deposition in cell wall Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0003983 UTP:glucose-1-phosphate uridylyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT5G17310

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.391

Rank 1 · LXL04_027698 · OH-1004

Plastid0.174

Rank 2 · LXL04_027698 · OH-1004

Nucleus0.159

Rank 3 · LXL04_027698 · OH-1004

Endoplasmic reticulum0.093

Rank 4 · LXL04_027698 · OH-1004

Cell membrane0.087

Rank 5 · LXL04_027698 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00318.26Ribosomal_S211-109 aa

PF00318.26Ribosomal_S2124-204 aa

PF01704.25UDPGP242-351 aa

PF01704.25UDPGP370-427 aa

PF01704.25UDPGP447-543 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027698	`PF00318.26`	Ribosomal_S2	11	109	2.9e-25	89.5
LXL04_027698	`PF00318.26`	Ribosomal_S2	124	204	2.9e-25	89.5
LXL04_027698	`PF01704.25`	UDPGP	242	351	4.2e-68	230.7
LXL04_027698	`PF01704.25`	UDPGP	370	427	4.2e-68	230.7
LXL04_027698	`PF01704.25`	UDPGP	447	543	4.2e-68	230.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P57751`	Arabidopsis thaliana	UTP--glucose-1-phosphate uridylyltransferase 1	43.418%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card