LXL04_027287 | RubberDandelionOmics

Gene overview

LXL04_027287

Reference: OH-1004 Chr: Chr06 Coordinates: 12531671-12540717 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4974 bp · LXL04_027287|LXL04_027287|OH1004|cDNA

AtgaaaagattaatcagatcAGAAAACACGACTCCAACTATTCTTGTTCTTCTTTCCTTGTTCCTTTGGAATTTATTATTCTTGATTTTATTTTCTCCCCTCTCTCAAGAATTCCATCTTTCTCTCTCTACGTATTTGCCTTTAATATTATCTTCATATTCTGTGATTTCCCGAGCGAAATCTCCTTTTGGGTTTCTTTGTTTTGACGATAGGGTTTCGTCCATACTTCCAATTTTCGACGCTTCAATGGAGACTGGTTC...

CDS

Download CDS FASTA

4974 bp · LXL04_027287|LXL04_027287|OH1004|CDS

ATGAAAAGATTAATCAGATCAGAAAACACGACTCCAACTATTCTTGTTCTTCTTTCCTTGTTCCTTTGGAATTTATTATTCTTGATTTTATTTTCTCCCCTCTCTCAAGAATTCCATCTTTCTCTCTCTACGTATTTGCCTTTAATATTATCTTCATATTCTGTGATTTCCCGAGCGAAATCTCCTTTTGGGTTTCTTTGTTTTGACGATAGGGTTTCGTCCATACTTCCAATTTTCGACGCTTCAATGGAGACTGGTTC...

Protein

Download Protein FASTA

1657 aa · LXL04_027287|LXL04_027287|OH1004|PROTEIN

MKRLIRSENTTPTILVLLSLFLWNLLFLILFSPLSQEFHLSLSTYLPLILSSYSVISRAKSPFGFLCFDDRVSSILPIFDASMETGSEGESNRNINGQSDGSKKPKRQMKTPFQLGMLEKTYALEMYPSEATRAKLSETLGLTDRQLQMWFCHRRLKDKKEGTVKQAAGGGGESLKSSKQELVVFGGSGGGGGGGSDHGSRSRSHRESPSRSRSASGSESESESDSSRLNEPLVHNRAYEATQKKMMIRRIIECVEVQLG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_027287`
TK1151 ID	TkA07G045930
OH-1004 ID	LXL04_027287
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.400
Protein coverage (%)	TK1151 90.560 / OH-1004 18.648 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_027287

Location Chr06:12531671-12540717 (-)

Description Similar to RLT2: Homeobox-DDT domain protein RLT2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g44180`	Transcriptional regulator required for the maintenance of the plant vegetative phase.	Imitation Switch chromatin remodeling factors and their interacting RINGLET proteins act together in controlling the plant vegetative phase in Arabidopsis.2012 · DOI: 10.1111/j.1365-313x.2012.05074.x Gene networks and chromatin and transcriptional regulation of the phaseolin promoter in Arabidopsis.2013 · DOI: 10.1105/tpc.113.112714
`At1g28420`	Transcriptional regulator required for the maintenance of the plant vegetative phase.	Imitation Switch chromatin remodeling factors and their interacting RINGLET proteins act together in controlling the plant vegetative phase in Arabidopsis.2012 · DOI: 10.1111/j.1365-313x.2012.05074.x
`At4g12750`	Transcriptional regulator required for the maintenance of the plant vegetative phase.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027287 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0009908 flower development Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

GO:0030154 cell differentiation Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0048510 regulation of timing of transition from vegetative to reproductive phase Biological Process

GO:0005634 nucleus Cellular Component

GO:0005667 transcription regulator complex Cellular Component

GO:0031010 ISWI-type complex Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G28420

ath:AT5G44180

ddi:DDB_G0284293

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.973

Rank 1 · LXL04_027287 · OH-1004

Cytoplasm0.073

Rank 2 · LXL04_027287 · OH-1004

Cell membrane0.028

Rank 3 · LXL04_027287 · OH-1004

Endoplasmic reticulum0.015

Rank 4 · LXL04_027287 · OH-1004

Plastid0.013

Rank 5 · LXL04_027287 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00046.36Homeodomain104-160 aa

PF02791.23DDT595-650 aa

PF05066.20HARE-HTH777-844 aa

PF15612.12WHIM1945-986 aa

PF15613.12WSD1084-1157 aa

PF31066.1DUF87991297-1360 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_027287	`PF00046.36`	Homeodomain	104	160	1.1e-15	57.9
LXL04_027287	`PF02791.23`	DDT	595	650	2.7e-21	76.1
LXL04_027287	`PF05066.20`	HARE-HTH	777	844	8.1e-16	58.9
LXL04_027287	`PF15612.12`	WHIM1	945	986	1.6e-06	28.3
LXL04_027287	`PF15613.12`	WSD	1084	1157	1.6e-21	76.9
LXL04_027287	`PF31066.1`	DUF8799	1297	1360	1.9e-21	76.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FFH1`	Arabidopsis thaliana	Homeobox-DDT domain protein RLT2	47.482%	Swiss-Prot	moderate database homology
`F4HY56`	Arabidopsis thaliana	Homeobox-DDT domain protein RLT1	45.823%	Swiss-Prot	moderate database homology
`F4JRF5`	Arabidopsis thaliana	Homeobox-DDT domain protein RLT3	26.620%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card