LXL04_026656 | RubberDandelionOmics

Gene overview

LXL04_026656

Reference: OH-1004 Chr: Chr06 Coordinates: 967086-971136 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3381 bp · LXL04_026656|LXL04_026656|OH1004|cDNA

ATGAACCCGGTTGGATCAGGGCCAATTGTTGATACCGTAGAGTCGGTGCCACGGTTAAAGAAGAGAAAAGGGAGGAGAAGGAGAACTAGGTCATCTTCTTCGCCATTAGCATTCGATAACCACACCAGAGCACCTTTATATCCAAATCCTAATTTTGCTTTCCTCATTACGTCACTGTTCGCACGGTTGATTGACTCTCAAGTTCTGATCTTGAGAAGCTCGTTTATTAGAGTAAAAACTACGATATGGAAGAGTCGAAG...

CDS

Download CDS FASTA

3381 bp · LXL04_026656|LXL04_026656|OH1004|CDS

ATGAACCCGGTTGGATCAGGGCCAATTGTTGATACCGTAGAGTCGGTGCCACGGTTAAAGAAGAGAAAAGGGAGGAGAAGGAGAACTAGGTCATCTTCTTCGCCATTAGCATTCGATAACCACACCAGAGCACCTTTATATCCAAATCCTAATTTTGCTTTCCTCATTACGTCACTGTTCGCACGGTTGATTGACTCTCAAGTTCTGATCTTGAGAAGCTCGTTTATTAGAGTAAAAACTACGATATGGAAGAGTCGAAG...

Protein

Download Protein FASTA

1126 aa · LXL04_026656|LXL04_026656|OH1004|PROTEIN

MNPVGSGPIVDTVESVPRLKKRKGRRRRTRSSSSPLAFDNHTRAPLYPNPNFAFLITSLFARLIDSQVLILRSSFIRVKTTIWKSRSINLARRKIMRREKERDRDKERERSVDDKYKEKEKHKERHRDKEKEKEKKEREREKERERERERAKEKENREKERERERVKEREREKEREREKEKERERRERREREERDREKMREKRREAERDHNSGGNDDVRDRDRKRRRRDDDHKEERERKVSSRRREDSVDNSVVSKKVDE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026656`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026656

Location Chr06:967086-971136 (-)

Description Similar to RH42: DEAD-box ATP-dependent RNA helicase 42

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g20920`	Helicase required for pre-mRNA splicing, cold-responsive gene regulation and cold tolerance.	A DEAD box RNA helicase is critical for pre-mRNA splicing, cold-responsive gene regulation, and cold tolerance in Arabidopsis.2013 · DOI: 10.1105/tpc.112.108340
`At3g09620`	DEAD-box ATP-dependent RNA helicase 45.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0154200`	DEAD-box ATP-dependent RNA helicase 45.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026656 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0035196 miRNA processing Biological Process

GO:1903241 U2-type prespliceosome assembly Biological Process

GO:0001650 fibrillar center Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005684 U2-type spliceosomal complex Cellular Component

GO:0015030 Cajal body Cellular Component

GO:0016607 nuclear speck Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003724 RNA helicase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

KEGG gene cross-reference

ath:AT1G20920

ath:AT3G09620

dosa:Os08g0154200

mmu:212880

rno:245957

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.957

Rank 1 · LXL04_026656 · OH-1004

Cytoplasm0.099

Rank 2 · LXL04_026656 · OH-1004

Cell membrane0.024

Rank 3 · LXL04_026656 · OH-1004

Endoplasmic reticulum0.012

Rank 4 · LXL04_026656 · OH-1004

Mitochondrion0.010

Rank 5 · LXL04_026656 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00270.36DEAD574-697 aa

PF00271.38Helicase_C737-843 aa

PF23469.2KH_121013-1082 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026656	`PF00270.36`	DEAD	574	697	9.8e-38	130.2
LXL04_026656	`PF00271.38`	Helicase_C	737	843	5.7e-30	104.5
LXL04_026656	`PF23469.2`	KH_12	1013	1082	3.7e-14	53.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8H0U8`	Arabidopsis thaliana	DEAD-box ATP-dependent RNA helicase 42	69.597%	Swiss-Prot	strong database homology
`Q9SF41`	Arabidopsis thaliana	DEAD-box ATP-dependent RNA helicase 45	68.092%	Swiss-Prot	strong database homology
`Q0J7Y8`	Oryza sativa subsp. japonica	DEAD-box ATP-dependent RNA helicase 45	63.205%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card