LXL04_026641 | RubberDandelionOmics

Gene overview

LXL04_026641

Reference: OH-1004 Chr: Chr06 Coordinates: 792921-794721 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1557 bp · LXL04_026641|LXL04_026641|OH1004|cDNA

ATGGACTTGAAACAACTAGCATTTATCATCATCTTTGTAGTTCTCGTATCTAGAATTATATCTTTATGGTTTGCCAAAATTTCCTTACAAACAGTTGGTAAACTTCCCCCAGGACCACCAAGGTGGCCTATTGTTGGTAATCTCCTCCAATTAGGGTCGTTGCCTCATAGAGATTTGGCTGCATTTTGTGAAAAATATGGACCATTGGTCTACCTTCGTCTTGGAAAAGTCAACGCCATCACCACCAATGACCCTAAGAT...

CDS

Download CDS FASTA

1557 bp · LXL04_026641|LXL04_026641|OH1004|CDS

ATGGACTTGAAACAACTAGCATTTATCATCATCTTTGTAGTTCTCGTATCTAGAATTATATCTTTATGGTTTGCCAAAATTTCCTTACAAACAGTTGGTAAACTTCCCCCAGGACCACCAAGGTGGCCTATTGTTGGTAATCTCCTCCAATTAGGGTCGTTGCCTCATAGAGATTTGGCTGCATTTTGTGAAAAATATGGACCATTGGTCTACCTTCGTCTTGGAAAAGTCAACGCCATCACCACCAATGACCCTAAGAT...

Protein

Download Protein FASTA

518 aa · LXL04_026641|LXL04_026641|OH1004|PROTEIN

MDLKQLAFIIIFVVLVSRIISLWFAKISLQTVGKLPPGPPRWPIVGNLLQLGSLPHRDLAAFCEKYGPLVYLRLGKVNAITTNDPKIIREILLQQDDVFASRPQTLAAVHLAYNCGDVALAPFGPRWKWMRRICMEQLLTTKRLESFAKQRESEAQHLVQDVWALTQTKGPINLREVLGAFSMNNVTRMLLGKQYFGSGSAGPKEALEFMHITHELFWLLGLIYLGDYLPFWRWIDPYGCEKKMREVEKRVDDFHMKIIE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_026641`
TK1151 ID	TkAUNG081120
OH-1004 ID	LXL04_026641
Relationship / confidence	Rbh High Identity Coverage Local Synteny Minor Chr Pair / Probable
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_026641

Location Chr06:792921-794721 (+)

Description Similar to CYP703A3: Cytochrome P450 703A2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g01280`	Involved in pollen wall development.	CYP703 is an ancient cytochrome P450 in land plants catalyzing in-chain hydroxylation of lauric acid to provide building blocks for sporopollenin synthesis in pollen.2007 · DOI: 10.1105/tpc.106.045948
`At5g07990`	Catalyzes the 3'-hydroxylation of the flavonoid B-ring to the 3',4'-hydroxylated state.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0131100`	Involved in pollen exine and anther epicuticular layer development.	Rice CYP703A3, a cytochrome P450 hydroxylase, is essential for development of anther cuticle and pollen exine.2014 · DOI: 10.1111/jipb.12212

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026641 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002933 lipid hydroxylation Biological Process

GO:0009411 response to UV Biological Process

GO:0009555 pollen development Biological Process

GO:0009733 response to auxin Biological Process

GO:0009813 flavonoid biosynthetic process Biological Process

GO:0010208 pollen wall assembly Biological Process

GO:0010584 pollen exine formation Biological Process

GO:0048653 anther development Biological Process

GO:0051791 medium-chain fatty acid metabolic process Biological Process

GO:0051792 medium-chain fatty acid biosynthetic process Biological Process

GO:0080027 response to herbivore Biological Process

GO:0080110 sporopollenin biosynthetic process Biological Process

KEGG gene cross-reference

ath:AT1G01280

ath:AT5G07990

dosa:Os08g0131100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.925

Rank 1 · LXL04_026641 · OH-1004

Cell membrane0.039

Rank 2 · LXL04_026641 · OH-1004

Cytoplasm0.034

Rank 3 · LXL04_026641 · OH-1004

Plastid0.027

Rank 4 · LXL04_026641 · OH-1004

Mitochondrion0.023

Rank 5 · LXL04_026641 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00067.28p45036-499 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_026641	`PF00067.28`	p450	36	499	3.2e-94	317.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LNJ4`	Arabidopsis thaliana	Cytochrome P450 703A2	75.828%	Swiss-Prot	strong database homology
`Q9SD85`	Arabidopsis thaliana	Flavonoid 3'-monooxygenase	36.873%	Swiss-Prot	moderate database homology
`Q7EZR4`	Oryza sativa subsp. japonica	Cytochrome P450 703A2	78.125%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card