LXL04_025885 | RubberDandelionOmics

Gene overview

LXL04_025885

Reference: OH-1004 Chr: Chr05 Coordinates: 118134586-118140297 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2835 bp · LXL04_025885|LXL04_025885|OH1004|cDNA

ATGGCGGCCTCCGTCGAAAACCGTCAGTTCCGCCATGAACATGGTGTTGTTCGTGCTTTCAGTCCTAATCATCAACGTTCTGACTCGCCAATCCGTGGCGGTATTAACTATCCCGCTGCTGCTAGAGAGTTTATGACGCCGAAGAAGCTACCTCCTGAAATTACCGATTCTAGTGACGATGAAGACGACGAGGGCGAGTATCGTGACGCCATTAAAAAGTCGAACGCTGAGTTGGAAAGCTCGGTTTTCGATCCCAGAGA...

CDS

Download CDS FASTA

2835 bp · LXL04_025885|LXL04_025885|OH1004|CDS

ATGGCGGCCTCCGTCGAAAACCGTCAGTTCCGCCATGAACATGGTGTTGTTCGTGCTTTCAGTCCTAATCATCAACGTTCTGACTCGCCAATCCGTGGCGGTATTAACTATCCCGCTGCTGCTAGAGAGTTTATGACGCCGAAGAAGCTACCTCCTGAAATTACCGATTCTAGTGACGATGAAGACGACGAGGGCGAGTATCGTGACGCCATTAAAAAGTCGAACGCTGAGTTGGAAAGCTCGGTTTTCGATCCCAGAGA...

Protein

Download Protein FASTA

944 aa · LXL04_025885|LXL04_025885|OH1004|PROTEIN

MAASVENRQFRHEHGVVRAFSPNHQRSDSPIRGGINYPAAAREFMTPKKLPPEITDSSDDEDDEGEYRDAIKKSNAELESSVFDPRDLGTADQWIERNPSMVRLTGKHPFNSEPPLTKLMQHGFITPAPLHYVRNHGAVPHATWDDWTVEICGLVKRPARFSMNQIANEFPSREFPATLVCAGNRRKEQNLTKQTIGFNWGAAGVSTSVWKGVPLVHILKRCGVYSRKKGAMNVCFEGAEDLPGGGGSKYGTSIKIEMAM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025885`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_025885`
Location	Chr05:118134586-118140297 (+)
Description	Similar to NIA: Nitrate reductase [NADH]
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_025885` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0006790 sulfur compound metabolic process Biological Process GO:0006809 nitric oxide biosynthetic process Biological Process GO:0009416 response to light stimulus Biological Process GO:0042128 nitrate assimilation Biological Process GO:0004128 cytochrome-b5 reductase activity, acting on NAD(P)H Molecular Function GO:0008482 sulfite oxidase activity Molecular Function GO:0009703 nitrate reductase (NADH) activity Molecular Function GO:0020037 heme binding Molecular Function GO:0030151 molybdenum ion binding Molecular Function GO:0043546 molybdopterin cofactor binding Molecular Function GO:0050464 nitrate reductase (NADPH) activity Molecular Function GO:0071949 FAD binding Molecular Function
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.535

Rank 1 · LXL04_025885 · OH-1004

Nucleus0.250

Rank 2 · LXL04_025885 · OH-1004

Peroxisome0.145

Rank 3 · LXL04_025885 · OH-1004

Mitochondrion0.142

Rank 4 · LXL04_025885 · OH-1004

Cell membrane0.075

Rank 5 · LXL04_025885 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00174.26Oxidored_molyb136-315 aa

PF03404.23Mo-co_dimer343-461 aa

PF00173.34Cyt-b5571-641 aa

PF00970.31FAD_binding_6692-798 aa

PF00175.27NAD_binding_1818-925 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025885	`PF00174.26`	Oxidored_molyb	136	315	4.5e-56	189.8
LXL04_025885	`PF03404.23`	Mo-co_dimer	343	461	1.4e-50	171.6
LXL04_025885	`PF00173.34`	Cyt-b5	571	641	1.6e-27	96.0
LXL04_025885	`PF00970.31`	FAD_binding_6	692	798	5.3e-37	126.9
LXL04_025885	`PF00175.27`	NAD_binding_1	818	925	4.2e-35	121.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card