LXL04_025057 | RubberDandelionOmics

Gene overview

LXL04_025057

Reference: OH-1004 Chr: Chr05 Coordinates: 104873363-104875669 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1413 bp · LXL04_025057|LXL04_025057|OH1004|cDNA

ATGGCAGGGGAAATCCAAGAGCCTTTTCGGCTAAATTTTCAGGCTGACCTCTTGCACTCTGGATCAATCTCGTTTGGAAGATTTGAATCTGAATCATTATCTTGGGAAAGGAGATCAATTTTTTCCCACAATAGATACCTTGAAGAGGTTGAAAAATACTCAAAACCAGGTACAGTTACAGAGAAAAAGGCTTATTTTGAGGCCGAGTTTAGAAGGAAAGCCCTTTTGAAGCAAGCCTCTTCTGAATCCCAAGATGGAGG...

CDS

Download CDS FASTA

1413 bp · LXL04_025057|LXL04_025057|OH1004|CDS

ATGGCAGGGGAAATCCAAGAGCCTTTTCGGCTAAATTTTCAGGCTGACCTCTTGCACTCTGGATCAATCTCGTTTGGAAGATTTGAATCTGAATCATTATCTTGGGAAAGGAGATCAATTTTTTCCCACAATAGATACCTTGAAGAGGTTGAAAAATACTCAAAACCAGGTACAGTTACAGAGAAAAAGGCTTATTTTGAGGCCGAGTTTAGAAGGAAAGCCCTTTTGAAGCAAGCCTCTTCTGAATCCCAAGATGGAGG...

Protein

Download Protein FASTA

470 aa · LXL04_025057|LXL04_025057|OH1004|PROTEIN

MAGEIQEPFRLNFQADLLHSGSISFGRFESESLSWERRSIFSHNRYLEEVEKYSKPGTVTEKKAYFEAEFRRKALLKQASSESQDGGDFSTSRNNDLHDLQDSDNVIESPSSSDPFEYTTETKIQQHEKAHVEAFYDDCQHNSRLDEDTISQDCEFLPVDKFEIHESEIVNVVGNTEEIVVDVVSEANDSSFIGQSQTLEKDDDSNITESRKMFSSKVKKPTRSTLKSQVNVDRFQKHVSNESHKAIMKPRTSETKKKTE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_025057`
TK1151 ID	TkA06G084540
OH-1004 ID	LXL04_025057
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_025057

Location Chr05:104873363-104875669 (-)

Description Similar to WDL7: Protein WVD2-like 7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g70950`	Microtubule-associated protein (MAP) that regulates the orientation of interphase cortical microtubules.	No verified direct reference in this release
`At2g25480`	Microtubule-associated protein (MAP) that regulates the orientation of interphase cortical microtubules.	No verified direct reference in this release
`At2g35880`	Microtubule-associated protein (MAP) that regulates the orientation of interphase cortical microtubules.	No verified direct reference in this release
`At4g32330`	Microtubule-associated protein (MAP) that regulates the orientation of interphase cortical microtubules.	No verified direct reference in this release
`At3g23090`	Microtubule-associated protein (MAP) that regulates the orientation of interphase cortical microtubules.	Light-regulated hypocotyl elongation involves proteasome-dependent degradation of the microtubule regulatory protein WDL3 in Arabidopsis.2013 · DOI: 10.1105/tpc.113.112789

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025057 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000226 microtubule cytoskeleton organization Biological Process

GO:0001578 microtubule bundle formation Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0043622 cortical microtubule organization Biological Process

GO:0051511 negative regulation of unidimensional cell growth Biological Process

GO:0071369 cellular response to ethylene stimulus Biological Process

GO:0072657 protein localization to membrane Biological Process

GO:0005634 nucleus Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005874 microtubule Cellular Component

GO:0055028 cortical microtubule Cellular Component

KEGG gene cross-reference

ath:AT1G70950

ath:AT2G25480

ath:AT2G35880

ath:AT3G23090

ath:AT4G32330

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.651

Rank 1 · LXL04_025057 · OH-1004

Nucleus0.326

Rank 2 · LXL04_025057 · OH-1004

Cell membrane0.139

Rank 3 · LXL04_025057 · OH-1004

Endoplasmic reticulum0.040

Rank 4 · LXL04_025057 · OH-1004

Golgi apparatus0.028

Rank 5 · LXL04_025057 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06886.17TPX2336-391 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_025057	`PF06886.17`	TPX2	336	391	4e-16	59.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q67Y69`	Arabidopsis thaliana	Protein WVD2-like 7	38.228%	Swiss-Prot	moderate database homology
`Q0WSZ8`	Arabidopsis thaliana	Protein WVD2-like 6	50.704%	Swiss-Prot	weak database homology
`Q9SJ62`	Arabidopsis thaliana	Protein WVD2-like 4	41.379%	Swiss-Prot	weak database homology
`Q94C48`	Arabidopsis thaliana	Protein WVD2-like 5	58.491%	Swiss-Prot	weak database homology
`Q84WL6`	Arabidopsis thaliana	Protein WVD2-like 3	46.296%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card