LXL04_023305 | RubberDandelionOmics

Gene overview

LXL04_023305

Reference: OH-1004 Chr: Chr05 Coordinates: 31599958-31601582 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1458 bp · LXL04_023305|LXL04_023305|OH1004|cDNA

ATGGCTGACGCTCATGATACCGACAAAAACATCGAGATATGGAAAATCAAGAAACTCATCAAGGCACTAGAAGCCGCACGTGGCAACGGAACAAGCATGATATCTCTCATCATGCCACCACGCGATCAAGTATCTCGCGTCACTAAAATGCTCGGAGACGAATTCGGAACCGCTTCCAACATCAAAAGCCGAGTAAACCGTCAGTCAGTTTTAGGCGCAATCACCTCCGCCCAACAACGCCTCAAACTCTACAACAAAGT...

CDS

Download CDS FASTA

1458 bp · LXL04_023305|LXL04_023305|OH1004|CDS

ATGGCTGACGCTCATGATACCGACAAAAACATCGAGATATGGAAAATCAAGAAACTCATCAAGGCACTAGAAGCCGCACGTGGCAACGGAACAAGCATGATATCTCTCATCATGCCACCACGCGATCAAGTATCTCGCGTCACTAAAATGCTCGGAGACGAATTCGGAACCGCTTCCAACATCAAAAGCCGAGTAAACCGTCAGTCAGTTTTAGGCGCAATCACCTCCGCCCAACAACGCCTCAAACTCTACAACAAAGT...

Protein

Download Protein FASTA

485 aa · LXL04_023305|LXL04_023305|OH1004|PROTEIN

MADAHDTDKNIEIWKIKKLIKALEAARGNGTSMISLIMPPRDQVSRVTKMLGDEFGTASNIKSRVNRQSVLGAITSAQQRLKLYNKVPPNGLVLYTGTIVTDDGKEKKVTIDFEPFRAINASLYLCDNKFHTEALNELLESDDKFGFIVMDGNGTLFGTLSGNTRELLHKFSVDLPKKHGRGGQSALRFARLRMEKRHNYVRKTAELATQFYINPSTSQPNVSGLILAGSADFKTELSQSDMFDPRLQAKILNVCDVSYG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_023305`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_023305

Location Chr05:31599958-31601582 (+)

Description Similar to ERF1-3: Eukaryotic peptide chain release factor subunit 1-3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g26618`	Directs the termination of nascent peptide synthesis (translation) in response to the termination codons UAA, UAG and UGA.	No verified direct reference in this release
`At5g47880`	Directs the termination of nascent peptide synthesis (translation) in response to the termination codons UAA, UAG and UGA.	Translation termination in Arabidopsis thaliana: characterisation of three versions of release factor 1.2004 · DOI: 10.1016/j.gene.2004.06.053 Cosuppression of eukaryotic release factor 1-1 in Arabidopsis affects cell elongation and radial cell division.2005 · DOI: 10.1104/pp.105.062695
`At1g12920`	Directs the termination of nascent peptide synthesis (translation) in response to the termination codons UAA, UAG and UGA.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023305 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0002184 cytoplasmic translational termination Biological Process

GO:0006415 translational termination Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009536 plastid Cellular Component

GO:0010494 cytoplasmic stress granule Cellular Component

GO:0018444 translation release factor complex Cellular Component

GO:0003747 translation release factor activity Molecular Function

GO:0016149 translation release factor activity, codon specific Molecular Function

GO:1990825 sequence-specific mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G12920

ath:AT3G26618

ath:AT5G47880

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.721

Rank 1 · LXL04_023305 · OH-1004

Nucleus0.350

Rank 2 · LXL04_023305 · OH-1004

Endoplasmic reticulum0.055

Rank 3 · LXL04_023305 · OH-1004

Mitochondrion0.040

Rank 4 · LXL04_023305 · OH-1004

Cell membrane0.036

Rank 5 · LXL04_023305 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03463.22eRF1_112-140 aa

PF03464.21eRF1_2144-277 aa

PF03465.21eRF1_3281-418 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_023305	`PF03463.22`	eRF1_1	12	140	1.8e-54	184.0
LXL04_023305	`PF03464.21`	eRF1_2	144	277	1.1e-41	143.0
LXL04_023305	`PF03465.21`	eRF1_3	281	418	2.5e-32	112.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P35614`	Arabidopsis thaliana	Eukaryotic peptide chain release factor subunit 1-3	89.412%	Swiss-Prot	strong database homology
`Q39097`	Arabidopsis thaliana	Eukaryotic peptide chain release factor subunit 1-1	88.679%	Swiss-Prot	strong database homology
`Q9LPV8`	Arabidopsis thaliana	Eukaryotic peptide chain release factor subunit 1-2	88.626%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card