LXL04_022993 | RubberDandelionOmics

Gene overview

LXL04_022993

Reference: OH-1004 Chr: Chr05 Coordinates: 16658740-16681422 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

12915 bp · LXL04_022993|LXL04_022993|OH1004|cDNA

ATGGCTAAAAGAAGGAGAAATTCTACACAACCATCTTCATCAAGAGGCAATgatgatgctaatgatgatgCTAATGATGCTAATTGGCTGCATAATGACTTCGAAAATCAAGATTACGGCGAAGACGAATTTGTTGATGAAACACCTACGGTTGATGTTATTAGTGACGACTCCGGCGAAGAAAACATCCCAAAACGTAACCCCAAACGTAACCCAAAACGTATCCCAAAACATATCCCGAAGAAAAGAAAACTCGATCA...

CDS

Download CDS FASTA

12915 bp · LXL04_022993|LXL04_022993|OH1004|CDS

ATGGCTAAAAGAAGGAGAAATTCTACACAACCATCTTCATCAAGAGGCAATGATGATGCTAATGATGATGCTAATGATGCTAATTGGCTGCATAATGACTTCGAAAATCAAGATTACGGCGAAGACGAATTTGTTGATGAAACACCTACGGTTGATGTTATTAGTGACGACTCCGGCGAAGAAAACATCCCAAAACGTAACCCCAAACGTAACCCAAAACGTATCCCAAAACATATCCCGAAGAAAAGAAAACTCGATCA...

Protein

Download Protein FASTA

4304 aa · LXL04_022993|LXL04_022993|OH1004|PROTEIN

MAKRRRNSTQPSSSRGNDDANDDANDANWLHNDFENQDYGEDEFVDETPTVDVISDDSGEENIPKRNPKRNPKRIPKHIPKKRKLDQAELRKRINPARRGEGKGHAPCWVAFDTQWIREEDGVEKKYGESNPENQQSDDDKQSKLSFKKDPSGEGHVYTWKHDEVRIAKAILGIFTIGELPFKWLENEACIELVNALNGRVILPSRHTASRNVAQLYLDERSKLLKHLSNPNTAVHLTTDTWTSPCQRKNYMVVTAHFID...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022993`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022993

Location Chr05:16658740-16681422 (-)

Description Similar to Putative AC transposase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0733400`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release
`Os05g0239150`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release
`Os05g0583200`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022993 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006310 DNA recombination Biological Process

GO:0032196 transposition Biological Process

GO:0003677 DNA binding Molecular Function

GO:0046983 protein dimerization activity Molecular Function

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.786

Rank 1 · LXL04_022993 · OH-1004

Cytoplasm0.355

Rank 2 · LXL04_022993 · OH-1004

Mitochondrion0.045

Rank 3 · LXL04_022993 · OH-1004

Cell membrane0.026

Rank 4 · LXL04_022993 · OH-1004

Extracellular0.025

Rank 5 · LXL04_022993 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27041.1ZBED1_RNase-like238-321 aa

PF27039.1ZBED1_RNase-like_helical333-429 aa

PF14372.13hAT-like_RNase-H469-560 aa

PF05699.20Dimer_Tnp_hAT617-698 aa

PF27041.1ZBED1_RNase-like1035-1118 aa

PF27039.1ZBED1_RNase-like_helical1130-1226 aa

PF14372.13hAT-like_RNase-H1266-1357 aa

PF05699.20Dimer_Tnp_hAT1414-1495 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022993	`PF27041.1`	ZBED1_RNase-like	238	321	1.2e-95	314.6
LXL04_022993	`PF27039.1`	ZBED1_RNase-like_helical	333	429	8.6e-105	345.4
LXL04_022993	`PF14372.13`	hAT-like_RNase-H	469	560	2.6e-56	188.5
LXL04_022993	`PF05699.20`	Dimer_Tnp_hAT	617	698	5e-139	453.2
LXL04_022993	`PF27041.1`	ZBED1_RNase-like	1035	1118	1.2e-95	314.6
LXL04_022993	`PF27039.1`	ZBED1_RNase-like_helical	1130	1226	8.6e-105	345.4
LXL04_022993	`PF14372.13`	hAT-like_RNase-H	1266	1357	2.6e-56	188.5
LXL04_022993	`PF05699.20`	Dimer_Tnp_hAT	1414	1495	5e-139	453.2
LXL04_022993	`PF27041.1`	ZBED1_RNase-like	1860	1943	1.2e-95	314.6
LXL04_022993	`PF27039.1`	ZBED1_RNase-like_helical	1955	2051	8.6e-105	345.4
LXL04_022993	`PF14372.13`	hAT-like_RNase-H	2091	2182	2.6e-56	188.5
LXL04_022993	`PF05699.20`	Dimer_Tnp_hAT	2239	2320	5e-139	453.2
LXL04_022993	`PF27041.1`	ZBED1_RNase-like	2700	2783	1.2e-95	314.6
LXL04_022993	`PF27039.1`	ZBED1_RNase-like_helical	2795	2891	8.6e-105	345.4
LXL04_022993	`PF14372.13`	hAT-like_RNase-H	2931	3022	2.6e-56	188.5
LXL04_022993	`PF05699.20`	Dimer_Tnp_hAT	3079	3160	5e-139	453.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6AVI0`	Oryza sativa subsp. japonica	Zinc finger BED domain-containing protein RICESLEEPER 2	26.860%	Swiss-Prot	weak database homology
`B9FJG3`	Oryza sativa subsp. japonica	Zinc finger BED domain-containing protein RICESLEEPER 1	26.173%	Swiss-Prot	weak database homology
`Q75HY5`	Oryza sativa subsp. japonica	Zinc finger BED domain-containing protein RICESLEEPER 3	25.316%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card