LXL04_022656 | RubberDandelionOmics

Gene overview

LXL04_022656

Reference: OH-1004 Chr: Chr05 Coordinates: 4176285-4178317 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

918 bp · LXL04_022656|LXL04_022656|OH1004|cDNA

ATGCTCTTctttttattaaatttgttaAAAATTCTAACCCTGCAGTACGAAAAAATTGAAAAGATTGGTGAAGGAACATATGGTGTGGTCTACAAGGCTCTCGACAAACTAACCAATAAAACTATTGCTTTGAAAAAGATTCCTTTAGAGAATCCAGATGAGGGAGTGCCTAGCACAGCTATAAGAGAAATCTCCCTGTTGAAAGAGATGAATCATGAAAATATTGTCAGGTTATATGATGTGGTGCATACTGAGGAAAA...

CDS

Download CDS FASTA

918 bp · LXL04_022656|LXL04_022656|OH1004|CDS

ATGCTCTTCTTTTTATTAAATTTGTTAAAAATTCTAACCCTGCAGTACGAAAAAATTGAAAAGATTGGTGAAGGAACATATGGTGTGGTCTACAAGGCTCTCGACAAACTAACCAATAAAACTATTGCTTTGAAAAAGATTCCTTTAGAGAATCCAGATGAGGGAGTGCCTAGCACAGCTATAAGAGAAATCTCCCTGTTGAAAGAGATGAATCATGAAAATATTGTCAGGTTATATGATGTGGTGCATACTGAGGAAAA...

Protein

Download Protein FASTA

305 aa · LXL04_022656|LXL04_022656|OH1004|PROTEIN

MLFFLLNLLKILTLQYEKIEKIGEGTYGVVYKALDKLTNKTIALKKIPLENPDEGVPSTAIREISLLKEMNHENIVRLYDVVHTEENLYLVFEFLDLDLLKHMDTCPEFSKDPHLVKMFLHQILTGISHCHSHRILHRDLKPPNLLIDLSTNTIKLADFGLARAFSVPLTTLTHEVVTLWYRAPEVLLGCEQYSTPLDVWAIGCIFAEMVTRQPLFNGDSEIDQLLKIFKIMGTPTEDTWPGVTSLRDFKASFPKWQPKD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022656`
TK1151 ID	TkA06G468190
OH-1004 ID	LXL04_022656
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 99.317 / OH-1004 95.410 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022656

Location Chr05:4176285-4178317 (+)

Description Similar to CDC2A: Cell division control protein 2 homolog A

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g48750`	Involved in the control of the cell cycle.	Cell division events are essential for embryo patterning and morphogenesis: studies on dominant-negative cdc2aAt mutants of arabidopsis.2000 · DOI: 10.1046/j.1365-313x.2000.00800.x Arabidopsis CDKA;1, a cdc2 homologue, controls proliferation of generative cells in male gametogenesis.2006 · DOI: 10.1111/j.1365-313x.2005.02643.x T-loop phosphorylation of Arabidopsis CDKA;1 is required for its function and can be partially substituted by an aspartate residue.2007 · DOI: 10.1105/tpc.107.050401

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022656 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000082 G1/S transition of mitotic cell cycle Biological Process

GO:0000086 G2/M transition of mitotic cell cycle Biological Process

GO:0000911 cytokinesis by cell plate formation Biological Process

GO:0007165 signal transduction Biological Process

GO:0008284 positive regulation of cell population proliferation Biological Process

GO:0008356 asymmetric cell division Biological Process

GO:0009409 response to cold Biological Process

GO:0009555 pollen development Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0010235 guard mother cell cytokinesis Biological Process

GO:0010389 regulation of G2/M transition of mitotic cell cycle Biological Process

GO:0010444 guard mother cell differentiation Biological Process

KEGG gene cross-reference

ath:AT3G48750

zma:542270

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.634

Rank 1 · LXL04_022656 · OH-1004

Nucleus0.600

Rank 2 · LXL04_022656 · OH-1004

Mitochondrion0.053

Rank 3 · LXL04_022656 · OH-1004

Cell membrane0.043

Rank 4 · LXL04_022656 · OH-1004

Endoplasmic reticulum0.031

Rank 5 · LXL04_022656 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069.32Pkinase16-299 aa

PF07714.24PK_Tyr_Ser-Thr18-212 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022656	`PF00069.32`	Pkinase	16	299	2.3e-76	257.4
LXL04_022656	`PF07714.24`	PK_Tyr_Ser-Thr	18	212	1.1e-31	110.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P24100`	Arabidopsis thaliana	Cyclin-dependent kinase A-1	72.917%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card