LXL04_021141 | RubberDandelionOmics

Gene overview

LXL04_021141

Reference: OH-1004 Chr: Chr04 Coordinates: 122244602-122247246 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

891 bp · LXL04_021141|LXL04_021141|OH1004|cDNA

ATGGATGATCAGAAAAGTGTCGATCCGCTCTCCGGAGACTGTAGCTGGACTCTCCACGGTGATTACGGCTTCTTCGGGATTAGCGATACAAGAGACAACAACATATTGAGCGAGTTCGGATGGAACATCCATCCTGCAGCGCCGGAATCAGATCGGATCGATTCTGGAGGTAGTTGTGGTGTGCCGGAGGAGATTAATCTTACTACTAGTGCAATTGCCTGTCAGTCTCAAGCTGGATCCGTTGAAAATGCAGGGGACGT...

CDS

Download CDS FASTA

891 bp · LXL04_021141|LXL04_021141|OH1004|CDS

ATGGATGATCAGAAAAGTGTCGATCCGCTCTCCGGAGACTGTAGCTGGACTCTCCACGGTGATTACGGCTTCTTCGGGATTAGCGATACAAGAGACAACAACATATTGAGCGAGTTCGGATGGAACATCCATCCTGCAGCGCCGGAATCAGATCGGATCGATTCTGGAGGTAGTTGTGGTGTGCCGGAGGAGATTAATCTTACTACTAGTGCAATTGCCTGTCAGTCTCAAGCTGGATCCGTTGAAAATGCAGGGGACGT...

Protein

Download Protein FASTA

296 aa · LXL04_021141|LXL04_021141|OH1004|PROTEIN

MDDQKSVDPLSGDCSWTLHGDYGFFGISDTRDNNILSEFGWNIHPAAPESDRIDSGGSCGVPEEINLTTSAIACQSQAGSVENAGDVSMSNPLVSTSSSEDRPESSAASGDAASFGKPPSSETGGKVKKKGPKRIRQQRFAFMTKSEIDHLEDGYRWRKYGQKAVKNSPFPRSYYRCTNSKCTVKKRVERSSTDPTTVITTYEGQHCHQTVGFPRGLLNHEGAYARLLASHSTTPQVIYPRTQSPLGTSQLQEKVVCNED...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_021141`
TK1151 ID	TkA05G356020
OH-1004 ID	LXL04_021141
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_021141

Location Chr04:122244602-122247246 (+)

Description Similar to WRKY57: Probable WRKY transcription factor 57

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g69310`	Transcription factor.	No verified direct reference in this release
`At1g29860`	Transcription factor.	No verified direct reference in this release
`At2g47260`	Transcription factor.	No verified direct reference in this release
`At4g18170`	Transcription factor.	No verified direct reference in this release
`At5g49520`	Transcription factor.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021141 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009617 response to bacterium Biological Process

GO:0009624 response to nematode Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009733 response to auxin Biological Process

GO:0010228 vegetative to reproductive phase transition of meristem Biological Process

GO:0042659 regulation of cell fate specification Biological Process

GO:0042742 defense response to bacterium Biological Process

KEGG gene cross-reference

ath:AT1G29860

ath:AT1G69310

ath:AT2G47260

ath:AT4G18170

ath:AT5G49520

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.935

Rank 1 · LXL04_021141 · OH-1004

Cytoplasm0.191

Rank 2 · LXL04_021141 · OH-1004

Mitochondrion0.024

Rank 3 · LXL04_021141 · OH-1004

Cell membrane0.022

Rank 4 · LXL04_021141 · OH-1004

Endoplasmic reticulum0.010

Rank 5 · LXL04_021141 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03106.22WRKY152-209 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_021141	`PF03106.22`	WRKY	152	209	1.5e-26	93.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9C983`	Arabidopsis thaliana	Probable WRKY transcription factor 57	47.249%	Swiss-Prot	moderate database homology
`Q93WV4`	Arabidopsis thaliana	WRKY transcription factor 71	50.299%	Swiss-Prot	moderate database homology
`O22900`	Arabidopsis thaliana	WRKY transcription factor 23	78.313%	Swiss-Prot	weak database homology
`Q8VWJ2`	Arabidopsis thaliana	WRKY transcription factor 28	75.000%	Swiss-Prot	weak database homology
`Q9FGZ4`	Arabidopsis thaliana	Probable WRKY transcription factor 48	64.646%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card