LXL04_019793 | RubberDandelionOmics

Gene overview

LXL04_019793

Reference: OH-1004 Chr: Chr04 Coordinates: 40278774-40281027 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1044 bp · LXL04_019793|LXL04_019793|OH1004|cDNA

ATGATTAAGCTTTTTTTATTGACACAGGACTTGAAATCAAGCAGAAAGATAACTCACCTCTATACAATCACACACTTGCCACAATTCTGGTGGAATATGCTTCTGCAACGGGGTTTTGAAGTTTTAGAGCTCATTGTTGATGTTGAGAACTGCCTGCAGGCCTTTGTTGGGGTTGCAGATGATCTTAATGCAATTATTATTGCATTCAGAGGTACCCAAGAAACCAGTGTACAGAATTGGATTGAGGACCTAATCTGGAA...

CDS

Download CDS FASTA

1044 bp · LXL04_019793|LXL04_019793|OH1004|CDS

ATGATTAAGCTTTTTTTATTGACACAGGACTTGAAATCAAGCAGAAAGATAACTCACCTCTATACAATCACACACTTGCCACAATTCTGGTGGAATATGCTTCTGCAACGGGGTTTTGAAGTTTTAGAGCTCATTGTTGATGTTGAGAACTGCCTGCAGGCCTTTGTTGGGGTTGCAGATGATCTTAATGCAATTATTATTGCATTCAGAGGTACCCAAGAAACCAGTGTACAGAATTGGATTGAGGACCTAATCTGGAA...

Protein

Download Protein FASTA

347 aa · LXL04_019793|LXL04_019793|OH1004|PROTEIN

MIKLFLLTQDLKSSRKITHLYTITHLPQFWWNMLLQRGFEVLELIVDVENCLQAFVGVADDLNAIIIAFRGTQETSVQNWIEDLIWKQLDSEYPGITDGKVHHGFFNAYNNTIVRSGILDGVSRAKKVYGDIKIMVTGHSMGGAMAAFCGLDLSLIYGKENVSVMTFGQPRIGNAAFASYYSEIAPNTFRITHEHDLVPHLPPYYQHLPHKTYHHFLREVIFNMRSFMTEENNVVSNSFLLDDDSSIPFSVDDISRSMDQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019793`
TK1151 ID	TkA07G125560
OH-1004 ID	LXL04_019793
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	72.900
Protein coverage (%)	TK1151 100.000 / OH-1004 61.383 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019793

Location Chr04:40278774-40281027 (-)

Description Similar to Lipase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g54560`	Myosin heavy chain that is required for the cell cycle-regulated transport of various organelles and proteins for their segregation.	No verified direct reference in this release
`At1g08730`	Myosin heavy chain that is required for the cell cycle-regulated transport of various organelles and proteins for their segregation.	No verified direct reference in this release
`At5g20490`	Myosin heavy chain that is required for the cell cycle-regulated transport of various organelles and proteins for their segregation.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019793 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000272 polysaccharide catabolic process Biological Process

GO:0006629 lipid metabolic process Biological Process

GO:0007015 actin filament organization Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0010090 trichome morphogenesis Biological Process

GO:0010091 trichome branching Biological Process

GO:0010154 fruit development Biological Process

GO:0016042 lipid catabolic process Biological Process

GO:0030048 actin filament-based movement Biological Process

GO:0044347 cell wall polysaccharide catabolic process Biological Process

KEGG gene cross-reference

ang:An09g00120

ath:AT1G08730

ath:AT1G54560

ath:AT5G20490

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.265

Rank 1 · LXL04_019793 · OH-1004

Lysosome / Vacuole0.220

Rank 2 · LXL04_019793 · OH-1004

Endoplasmic reticulum0.150

Rank 3 · LXL04_019793 · OH-1004

Extracellular0.146

Rank 4 · LXL04_019793 · OH-1004

Plastid0.106

Rank 5 · LXL04_019793 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01764.32Lipase_366-204 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019793	`PF01764.32`	Lipase_3	66	204	1.6e-35	122.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4HWY6`	Arabidopsis thaliana	Myosin-11	74.286%	Swiss-Prot	weak database homology
`F4HXP9`	Arabidopsis thaliana	Myosin-9	74.286%	Swiss-Prot	weak database homology
`F4K5J1`	Arabidopsis thaliana	Myosin-17	68.571%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card