LXL04_019377 | RubberDandelionOmics

Gene overview

LXL04_019377

Reference: OH-1004 Chr: Chr04 Coordinates: 30141529-30144000 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1131 bp · LXL04_019377|LXL04_019377|OH1004|cDNA

ATGGCAACAAACGGCGCTACCGGTGATGGGAGCGATCCTGCAAACACTATAAAAGTAAGCGTGAAGTTCAACGGACGATCAATACCGGTGAGCCTTTCTGTTGAATCCACCGTCAAAGACCTAAAATCTCTCCTTCAACCTCTCACCGATGTTCTTCCTCGCGGCCAAAAACTAATCGCTAAGGGGAAAATTCTTGACGATGAGATGAAATTTAGTTCGTTGGGGACATACAGTGGTGTCTATAAGATACAGCTCCTAGC...

CDS

Download CDS FASTA

1131 bp · LXL04_019377|LXL04_019377|OH1004|CDS

ATGGCAACAAACGGCGCTACCGGTGATGGGAGCGATCCTGCAAACACTATAAAAGTAAGCGTGAAGTTCAACGGACGATCAATACCGGTGAGCCTTTCTGTTGAATCCACCGTCAAAGACCTAAAATCTCTCCTTCAACCTCTCACCGATGTTCTTCCTCGCGGCCAAAAACTAATCGCTAAGGGGAAAATTCTTGACGATGAGATGAAATTTAGTTCGTTGGGGACATACAGTGGTGTCTATAAGATACAGCTCCTAGC...

Protein

Download Protein FASTA

376 aa · LXL04_019377|LXL04_019377|OH1004|PROTEIN

MATNGATGDGSDPANTIKVSVKFNGRSIPVSLSVESTVKDLKSLLQPLTDVLPRGQKLIAKGKILDDEMKFSSLGTYSGVYKIQLLASQGLHQGSGPIKKESPVVSNLRKTPETNKREKQVTVVKNQFERWKLTGVIALSNSDIKVIPQEVWKCGSSVRFLDLNCNSIQDIPDAIGELSSLQKLLLNANCIEDEFLSWKGLSSLKSLSLLSLNQNLLTNLPSDLGALTTLKELHVANNKLTCLPDEIGLLVHLEVLEAND...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019377`
TK1151 ID	TkA05G048040
OH-1004 ID	LXL04_019377
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019377

Location Chr04:30141529-30144000 (+)

Description Similar to At2g30105: LRR repeats and ubiquitin-like domain-containing protein At2g30105

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g30105`	LRR repeats and ubiquitin-like domain-containing protein At2g30105.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os10g0456200`	Leucine-rich repeat protein that likely mediates protein interactions, possibly in the context of signal transduction.	No verified direct reference in this release
`Os03g0212200`	Leucine-rich repeat protein that likely mediates protein interactions, possibly in the context of signal transduction.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019377 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0035556 intracellular signal transduction Biological Process

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT2G30105

dosa:Os03g0212200

dosa:Os10g0456200

rno:311346

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.614

Rank 1 · LXL04_019377 · OH-1004

Nucleus0.377

Rank 2 · LXL04_019377 · OH-1004

Cell membrane0.085

Rank 3 · LXL04_019377 · OH-1004

Golgi apparatus0.059

Rank 4 · LXL04_019377 · OH-1004

Endoplasmic reticulum0.050

Rank 5 · LXL04_019377 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00240.30ubiquitin17-89 aa

PF14580.13LRR_9107-220 aa

PF13855.13LRR_8137-189 aa

PF23598.2LRR_14138-236 aa

PF23598.2LRR_14202-329 aa

PF13855.13LRR_8206-263 aa

PF13855.13LRR_8229-286 aa

PF13855.13LRR_8252-309 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019377	`PF00240.30`	ubiquitin	17	89	3.1e-10	40.4
LXL04_019377	`PF14580.13`	LRR_9	107	220	2.2e-06	28.1
LXL04_019377	`PF13855.13`	LRR_8	137	189	3.9e-21	75.3
LXL04_019377	`PF23598.2`	LRR_14	138	236	1.3e-16	61.0
LXL04_019377	`PF23598.2`	LRR_14	202	329	1.3e-16	61.0
LXL04_019377	`PF13855.13`	LRR_8	206	263	3.9e-21	75.3
LXL04_019377	`PF13855.13`	LRR_8	229	286	3.9e-21	75.3
LXL04_019377	`PF13855.13`	LRR_8	252	309	3.9e-21	75.3
LXL04_019377	`PF12799.14`	LRR_4	252	295	1.4e-18	67.2
LXL04_019377	`PF13855.13`	LRR_8	297	343	3.9e-21	75.3
LXL04_019377	`PF12799.14`	LRR_4	298	336	1.4e-18	67.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P0C895`	Arabidopsis thaliana	LRR repeats and ubiquitin-like domain-containing protein At2g30105	54.865%	Swiss-Prot	strong database homology
`Q7XDQ7`	Oryza sativa subsp. japonica	Plant intracellular Ras-group-related LRR protein 8	55.978%	Swiss-Prot	strong database homology
`B9F655`	Oryza sativa subsp. japonica	Plant intracellular Ras-group-related LRR protein 7	36.255%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card