LXL04_019336 | RubberDandelionOmics

Gene overview

LXL04_019336

Reference: OH-1004 Chr: Chr04 Coordinates: 29129628-29133982 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1491 bp · LXL04_019336|LXL04_019336|OH1004|cDNA

ATGGGCCGGTTTGAATCCAATAAGAGAAAAAGCCCAAAAGAGCCCAAAAACTTGGCGCGTGTAGTGTACTACTTGCTATTCAGTAGTTTGTTTTCGCTTGTTGGGGACAGATCAACATTCAAAGCGGAACCCCAACGTAATCGCCCGCCCGGTGACACCCTCCGAAATCGGAGAAGCAAAACCCTACGTGAAACCATGTATGGGGGAGACGAAGTATCGGCGATAGTTGTAGACTTGGGTTCGCATACATGTAAAGCTGG...

CDS

Download CDS FASTA

1491 bp · LXL04_019336|LXL04_019336|OH1004|CDS

ATGGGCCGGTTTGAATCCAATAAGAGAAAAAGCCCAAAAGAGCCCAAAAACTTGGCGCGTGTAGTGTACTACTTGCTATTCAGTAGTTTGTTTTCGCTTGTTGGGGACAGATCAACATTCAAAGCGGAACCCCAACGTAATCGCCCGCCCGGTGACACCCTCCGAAATCGGAGAAGCAAAACCCTACGTGAAACCATGTATGGGGGAGACGAAGTATCGGCGATAGTTGTAGACTTGGGTTCGCATACATGTAAAGCTGG...

Protein

Download Protein FASTA

496 aa · LXL04_019336|LXL04_019336|OH1004|PROTEIN

MGRFESNKRKSPKEPKNLARVVYYLLFSSLFSLVGDRSTFKAEPQRNRPPGDTLRNRRSKTLRETMYGGDEVSAIVVDLGSHTCKAGYAGEDAPKAVFPSVIGAIDQMEVDETDNPEKNSEPKSKGKRKLYVGSSAMGYRRDHMEVLPSIKDGIVTDWDIVESIWDHAFKECLLVDPKEHPMLLAEPSSNTQQQREKAAELMFEKYQAPALFLAKNAVLTSFASGRATSLVVDSGGGSTIVAPVHDGYVLQKAVSSSPIG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019336`
TK1151 ID	TkA05G043780
OH-1004 ID	LXL04_019336
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 93.145 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_019336

Location Chr04:29129628-29133982 (-)

Description Similar to ARP4: Actin-related protein 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g18450`	Involved in several developmental processes including organization of plant organs, flowering time, anther development, flower senescence and fertility, probably by regulating the chromatin structure.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0137200`	Involved in several developmental processes including organization of plant organs, flowering time, anther development, flower senescence and fertility, probably by regulating the chromatin structure.	No verified direct reference in this release
`UniProt: A2YR10`	Involved in several developmental processes including organization of plant organs, flowering time, anther development, flower senescence and fertility, probably by regulating the chromatin structure.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019336 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000723 telomere maintenance Biological Process

GO:0006275 regulation of DNA replication Biological Process

GO:0006281 DNA repair Biological Process

GO:0006282 regulation of DNA repair Biological Process

GO:0006310 DNA recombination Biological Process

GO:0006325 chromatin organization Biological Process

GO:0006338 chromatin remodeling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0008284 positive regulation of cell population proliferation Biological Process

GO:0030071 regulation of mitotic metaphase/anaphase transition Biological Process

KEGG gene cross-reference

ath:AT1G18450

dosa:Os08g0137200

mmu:56456

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.665

Rank 1 · LXL04_019336 · OH-1004

Cytoplasm0.412

Rank 2 · LXL04_019336 · OH-1004

Cell membrane0.054

Rank 3 · LXL04_019336 · OH-1004

Mitochondrion0.040

Rank 4 · LXL04_019336 · OH-1004

Lysosome / Vacuole0.040

Rank 5 · LXL04_019336 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00022.27Actin69-496 aa

PF06723.20MreB_Mbl137-270 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019336	`PF00022.27`	Actin	69	496	9.3e-160	532.4
LXL04_019336	`PF06723.20`	MreB_Mbl	137	270	2.3e-06	27.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84M92`	Arabidopsis thaliana	Actin-related protein 4	78.458%	Swiss-Prot	strong database homology
`Q6ZJW9`	Oryza sativa subsp. japonica	Actin-related protein 4	71.685%	Swiss-Prot	strong database homology
`A2YR10`	Oryza sativa subsp. indica	Actin-related protein 4	71.685%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card