LXL04_018953 | RubberDandelionOmics

Gene overview

LXL04_018953

Reference: OH-1004 Chr: Chr04 Coordinates: 20351637-20354477 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1032 bp · LXL04_018953|LXL04_018953|OH1004|cDNA

ATGGATCAACACAGAGACTACCGTTCTTCTTTGTCCTACGACAACTCTATCCCTCCTCCCAACTACCACGACGGTAGCAACTTTAACCATGGTGGTGACGGCCACTACGATCATCACCGTAGATACCAAAACCACCATCAAGATTTTGGTAACGAACCAACCGATTCATTTGGACACGCCAATGGAACTGCATTTGCTGGACGAAAGCGACAATTCTCTCACTCTGCTCTTGGAGCTCCTGGATACAACAATGATAGCAA...

CDS

Download CDS FASTA

1032 bp · LXL04_018953|LXL04_018953|OH1004|CDS

ATGGATCAACACAGAGACTACCGTTCTTCTTTGTCCTACGACAACTCTATCCCTCCTCCCAACTACCACGACGGTAGCAACTTTAACCATGGTGGTGACGGCCACTACGATCATCACCGTAGATACCAAAACCACCATCAAGATTTTGGTAACGAACCAACCGATTCATTTGGACACGCCAATGGAACTGCATTTGCTGGACGAAAGCGACAATTCTCTCACTCTGCTCTTGGAGCTCCTGGATACAACAATGATAGCAA...

Protein

Download Protein FASTA

343 aa · LXL04_018953|LXL04_018953|OH1004|PROTEIN

MDQHRDYRSSLSYDNSIPPPNYHDGSNFNHGGDGHYDHHRRYQNHHQDFGNEPTDSFGHANGTAFAGRKRQFSHSALGAPGYNNDSNYAKLYVKGVPREASEQDIQSLFGKHGNIIEVVLFKQLKNVQEQDCCFVKYAKTEDAAQAIRSLHNQHIFPGGIRPIEVKYASTSKKQERIGLGGFRGNECKLFVASLNKHASEGEIAQIFSPYGCVEEVFLLRDEQKQNRGTGFITFTQKDMAIAAINALSGTFIMKGCEQPL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018953`
TK1151 ID	TkA05G005250
OH-1004 ID	LXL04_018953
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018953

Location Chr04:20351637-20354477 (-)

Description Similar to FCA: Flowering time control protein FCA

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g16280`	Plays a major role in the promotion of the transition of the vegetative meristem to reproductive development.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: B8BCZ8`	Plays a major role in the promotion of the transition of the vegetative meristem to reproductive development (By similarity).	No verified direct reference in this release
`Os09g0123200`	Plays a major role in the promotion of the transition of the vegetative meristem to reproductive development.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018953 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0008361 regulation of cell size Biological Process

GO:0009553 embryo sac development Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0009908 flower development Biological Process

GO:0009909 regulation of flower development Biological Process

GO:0030154 cell differentiation Biological Process

GO:0031048 regulatory ncRNA-mediated heterochromatin formation Biological Process

GO:0048510 regulation of timing of transition from vegetative to reproductive phase Biological Process

GO:0080113 regulation of seed growth Biological Process

GO:0000785 chromatin Cellular Component

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT4G16280

dosa:Os09g0123200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.608

Rank 1 · LXL04_018953 · OH-1004

Cytoplasm0.478

Rank 2 · LXL04_018953 · OH-1004

Cell membrane0.062

Rank 3 · LXL04_018953 · OH-1004

Endoplasmic reticulum0.035

Rank 4 · LXL04_018953 · OH-1004

Lysosome / Vacuole0.027

Rank 5 · LXL04_018953 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00076.29RRM_191-154 aa

PF00076.29RRM_1189-253 aa

PF00397.33WW298-325 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018953	`PF00076.29`	RRM_1	91	154	1e-31	109.3
LXL04_018953	`PF00076.29`	RRM_1	189	253	1e-31	109.3
LXL04_018953	`PF00397.33`	WW	298	325	1.7e-08	35.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O04425`	Arabidopsis thaliana	Flowering time control protein FCA	46.977%	Swiss-Prot	moderate database homology
`B8BCZ8`	Oryza sativa subsp. indica	Flowering time control protein FCA	49.744%	Swiss-Prot	moderate database homology
`Q6K271`	Oryza sativa subsp. japonica	Flowering time control protein FCA	49.744%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card