LXL04_018550 | RubberDandelionOmics

Gene overview

LXL04_018550

Reference: OH-1004 Chr: Chr04 Coordinates: 14510161-14517843 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3228 bp · LXL04_018550|LXL04_018550|OH1004|cDNA

ATGACAGTTGGATCTGATTGTCCGTTAGCAAATAGAACAAGGGCCTTTCCTAACAAATTTCCATACGAAGCACAATGCAAAAAAAACCATCTTAATTTAAATCCAGCAAGAAACACAAGCGTGATCACATACGCATTTAGCTTCGGAAATTTTTCTCTTCTCTCTCCACACATTTTCTTGACCTGGCGAAATTCACCGACTGCGAGGGTTTGCATGATGAACAGCGGCAGCGGTAGTAATGAACCAGCTGCCGATCTGTG...

CDS

Download CDS FASTA

3228 bp · LXL04_018550|LXL04_018550|OH1004|CDS

ATGACAGTTGGATCTGATTGTCCGTTAGCAAATAGAACAAGGGCCTTTCCTAACAAATTTCCATACGAAGCACAATGCAAAAAAAACCATCTTAATTTAAATCCAGCAAGAAACACAAGCGTGATCACATACGCATTTAGCTTCGGAAATTTTTCTCTTCTCTCTCCACACATTTTCTTGACCTGGCGAAATTCACCGACTGCGAGGGTTTGCATGATGAACAGCGGCAGCGGTAGTAATGAACCAGCTGCCGATCTGTG...

Protein

Download Protein FASTA

1075 aa · LXL04_018550|LXL04_018550|OH1004|PROTEIN

MTVGSDCPLANRTRAFPNKFPYEAQCKKNHLNLNPARNTSVITYAFSFGNFSLLSPHIFLTWRNSPTARVCMMNSGSGSNEPAADLCNEPNLDLESWINELYSADFRDPLMNFGLEEIMTAKPNYTYQPHINTVNNGPFFGGSSSSDKSQCGILNELMTVSNSTHYNSNTSTFQSNSTHYNSNTSTYQTSGHLLSPIPQFISTSVSSSSITCKTTVMIQSPNHNQRFKQPMVSQNTPTYTTTSQPTILFGQNSNSQQMTL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018550`
TK1151 ID	TkA08G067720
OH-1004 ID	LXL04_018550
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 93.395 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018550

Location Chr04:14510161-14517843 (-)

Description Similar to MED15A: Mediator of RNA polymerase II transcription subunit 15a

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g15780`	Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes.	No verified direct reference in this release
`At2g10440`	Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018550 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009751 response to salicylic acid Biological Process

GO:0045723 positive regulation of fatty acid biosynthetic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0016592 mediator complex Cellular Component

GO:0003713 transcription coactivator activity Molecular Function

GO:0031490 chromatin DNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G15780

ath:AT2G10440

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.926

Rank 1 · LXL04_018550 · OH-1004

Cytoplasm0.182

Rank 2 · LXL04_018550 · OH-1004

Cell membrane0.023

Rank 3 · LXL04_018550 · OH-1004

Mitochondrion0.015

Rank 4 · LXL04_018550 · OH-1004

Endoplasmic reticulum0.011

Rank 5 · LXL04_018550 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4I171`	Arabidopsis thaliana	Mediator of RNA polymerase II transcription subunit 15a	32.915%	Swiss-Prot	weak database homology
`Q9SHV7`	Arabidopsis thaliana	Probable mediator of RNA polymerase II transcription subunit 15c	30.870%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card