LXL04_018269 | RubberDandelionOmics

Gene overview

LXL04_018269

Reference: OH-1004 Chr: Chr04 Coordinates: 10117668-10118655 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

852 bp · LXL04_018269|LXL04_018269|OH1004|cDNA

ATGATTCAACACCCTGTTCTTGGTAACAACAATGGCGGAGGTGAAGTCAACACAAACCCACCAAAGTCAACACCTTTACCCCCAATTCAAAGAGTCAACCCGGTCAACCGAGGGACCACAAACATATTCTACAAGACTCGAATGTGCCAGAAGTTTCTAGAAGGAACATGTCGGAATGGAGACGGCTGTACTTTTGCACACGGGTCCCAAGATTTACGCGAACCGCCACCTAATTGGCCAGATCTTGTGAGGGATAACAG...

CDS

Download CDS FASTA

852 bp · LXL04_018269|LXL04_018269|OH1004|CDS

ATGATTCAACACCCTGTTCTTGGTAACAACAATGGCGGAGGTGAAGTCAACACAAACCCACCAAAGTCAACACCTTTACCCCCAATTCAAAGAGTCAACCCGGTCAACCGAGGGACCACAAACATATTCTACAAGACTCGAATGTGCCAGAAGTTTCTAGAAGGAACATGTCGGAATGGAGACGGCTGTACTTTTGCACACGGGTCCCAAGATTTACGCGAACCGCCACCTAATTGGCCAGATCTTGTGAGGGATAACAG...

Protein

Download Protein FASTA

283 aa · LXL04_018269|LXL04_018269|OH1004|PROTEIN

MIQHPVLGNNNGGGEVNTNPPKSTPLPPIQRVNPVNRGTTNIFYKTRMCQKFLEGTCRNGDGCTFAHGSQDLREPPPNWPDLVRDNRGGQNWNDDQRIIHQMRICHKFVNTGECPYGEKCNFLHESPAKFKAQSERTRESSVIKIQTMVDRGQSQPNGGQRLHSNMNAVQVSSVSSDPNATFWKTRICSKWELTGQCGFGDKCHFAHGLAELNTPVVRMDGGGSNAASSLHLAATELPPSDSAMAVPFQQGEGKGFAKLR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018269`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_018269

Location Chr04:10117668-10118655 (+)

Description Similar to At3g19360: Zinc finger CCCH domain-containing protein 39

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g19360`	Zinc finger CCCH domain-containing protein 39.	No verified direct reference in this release
`At1g32360`	Zinc finger CCCH domain-containing protein 12.	No verified direct reference in this release
`At2g35430`	Zinc finger CCCH domain-containing protein 28.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os08g0159800`	Zinc finger CCCH domain-containing protein 56.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018269 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0003729 mRNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G32360

ath:AT2G35430

ath:AT3G19360

dosa:Os08g0159800

osa:4344715

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.625

Rank 1 · LXL04_018269 · OH-1004

Cytoplasm0.419

Rank 2 · LXL04_018269 · OH-1004

Cell membrane0.047

Rank 3 · LXL04_018269 · OH-1004

Endoplasmic reticulum0.030

Rank 4 · LXL04_018269 · OH-1004

Mitochondrion0.026

Rank 5 · LXL04_018269 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25427.3zf-CCCH_UNK43-75 aa

PF00642.31zf-CCCH44-68 aa

PF18044.8zf-CCCH_447-67 aa

PF18345.8zf_CCCH_449-67 aa

PF00642.31zf-CCCH102-124 aa

PF25585.2zf-CCCH_DUS3L103-124 aa

PF18044.8zf-CCCH_4103-124 aa

PF18345.8zf_CCCH_4105-124 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018269	`PF25427.3`	zf-CCCH_UNK	43	75	1.3e-11	44.9
LXL04_018269	`PF00642.31`	zf-CCCH	44	68	9.5e-25	86.7
LXL04_018269	`PF18044.8`	zf-CCCH_4	47	67	1.6e-15	57.2
LXL04_018269	`PF18345.8`	zf_CCCH_4	49	67	1.5e-15	57.3
LXL04_018269	`PF00642.31`	zf-CCCH	102	124	9.5e-25	86.7
LXL04_018269	`PF25585.2`	zf-CCCH_DUS3L	103	124	3.9e-16	59.4
LXL04_018269	`PF18044.8`	zf-CCCH_4	103	124	1.6e-15	57.2
LXL04_018269	`PF18345.8`	zf_CCCH_4	105	124	1.5e-15	57.3
LXL04_018269	`PF00642.31`	zf-CCCH	183	208	9.5e-25	86.7
LXL04_018269	`PF25585.2`	zf-CCCH_DUS3L	184	207	3.9e-16	59.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LT81`	Arabidopsis thaliana	Zinc finger CCCH domain-containing protein 39	39.628%	Swiss-Prot	moderate database homology
`Q9LQM3`	Arabidopsis thaliana	Zinc finger CCCH domain-containing protein 12	31.046%	Swiss-Prot	moderate database homology
`Q5PP65`	Arabidopsis thaliana	Zinc finger CCCH domain-containing protein 28	31.606%	Swiss-Prot	moderate database homology
`Q84UQ3`	Oryza sativa subsp. japonica	Zinc finger CCCH domain-containing protein 56	30.508%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card