LXL04_017523 | RubberDandelionOmics

Gene overview

LXL04_017523

Reference: OH-1004 Chr: Chr03 Coordinates: 152396117-152401872 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2457 bp · LXL04_017523|LXL04_017523|OH1004|cDNA

ATGGCGGAGCACGGTGGCGGAGGTGGATGTTGCCCGCCGATGGATCTGTTTCGTTCAGAACCGATGCATCTGATACAAGTCATTATCCCAATCGAGTCCGCTCGCTTGACCGTCTCGTACCTTGGAGATATCGGCCTCATTCAATTCAAAGATCTGAACGTAGAAAAAAGCCCTTTTCAGCGAACATATGCAGGCCAGATTAAAAGATGCGCTGAGCTGGCACGAAAGTTGCGGTTCTTCAAAGATCAAATGTCAAAGGC...

CDS

Download CDS FASTA

2457 bp · LXL04_017523|LXL04_017523|OH1004|CDS

ATGGCGGAGCACGGTGGCGGAGGTGGATGTTGCCCGCCGATGGATCTGTTTCGTTCAGAACCGATGCATCTGATACAAGTCATTATCCCAATCGAGTCCGCTCGCTTGACCGTCTCGTACCTTGGAGATATCGGCCTCATTCAATTCAAAGATCTGAACGTAGAAAAAAGCCCTTTTCAGCGAACATATGCAGGCCAGATTAAAAGATGCGCTGAGCTGGCACGAAAGTTGCGGTTCTTCAAAGATCAAATGTCAAAGGC...

Protein

Download Protein FASTA

818 aa · LXL04_017523|LXL04_017523|OH1004|PROTEIN

MAEHGGGGGCCPPMDLFRSEPMHLIQVIIPIESARLTVSYLGDIGLIQFKDLNVEKSPFQRTYAGQIKRCAELARKLRFFKDQMSKADIIPSGKPNTKAVLNLDDIEVNLGDLEAELTEMNANSEKLQRGYNELVEYKLVLQKAGEIFNVAQSSATAQHGESSSHHGEESLESPLLKDQVDQGKQVKLGFLTGLVPKEKAMAFERILFRATRGNVFLRQASVEEAVTDPNSGQKVQKSVFVVFFSGERAKNKILKICEAF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017523`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017523

Location Chr03:152396117-152401872 (-)

Description Similar to VHA-a3: V-type proton ATPase subunit a3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g39080`	Essential component of the vacuolar proton pump (V-ATPase), a multimeric enzyme that catalyzes the translocation of protons across the membranes.	Arabidopsis V-ATPase activity at the tonoplast is required for efficient nutrient storage but not for sodium accumulation.2010 · DOI: 10.1073/pnas.0913035107
`At2g21410`	Essential component of the vacuolar proton pump (V-ATPase), a multimeric enzyme that catalyzes the translocation of protons across the membranes.	Arabidopsis V-ATPase activity at the tonoplast is required for efficient nutrient storage but not for sodium accumulation.2010 · DOI: 10.1073/pnas.0913035107
`At2g28520`	Essential component of the vacuolar proton pump (V-ATPase), a multimeric enzyme that catalyzes the translocation of protons across the membranes.	Reduced V-ATPase activity in the trans-Golgi network causes oxylipin-dependent hypocotyl growth Inhibition in Arabidopsis.2008 · DOI: 10.1105/tpc.108.058362

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017523 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006911 phagocytosis, engulfment Biological Process

GO:0007035 vacuolar acidification Biological Process

GO:0015986 proton motive force-driven ATP synthesis Biological Process

GO:0016241 regulation of macroautophagy Biological Process

GO:0051453 regulation of intracellular pH Biological Process

GO:0070070 proton-transporting V-type ATPase complex assembly Biological Process

GO:1902600 proton transmembrane transport Biological Process

GO:2000012 regulation of auxin polar transport Biological Process

GO:0000220 vacuolar proton-transporting V-type ATPase, V0 domain Cellular Component

GO:0000325 plant-type vacuole Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT2G21410

ath:AT2G28520

ath:AT4G39080

ddi:DDB_G0291858

mmu:11975

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.357

Rank 1 · LXL04_017523 · OH-1004

Golgi apparatus0.290

Rank 2 · LXL04_017523 · OH-1004

Cytoplasm0.221

Rank 3 · LXL04_017523 · OH-1004

Cell membrane0.181

Rank 4 · LXL04_017523 · OH-1004

Lysosome / Vacuole0.170

Rank 5 · LXL04_017523 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01496.25V_ATPase_I40-810 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017523	`PF01496.25`	V_ATPase_I	40	810		1020.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8W4S4`	Arabidopsis thaliana	V-type proton ATPase subunit a3	76.005%	Swiss-Prot	strong database homology
`Q9SJT7`	Arabidopsis thaliana	V-type proton ATPase subunit a2	75.248%	Swiss-Prot	strong database homology
`Q8RWZ7`	Arabidopsis thaliana	V-type proton ATPase subunit a1	62.608%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card