LXL04_016324 | RubberDandelionOmics

Gene overview

LXL04_016324

Reference: OH-1004 Chr: Chr03 Coordinates: 118934839-118935972 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1134 bp · LXL04_016324|LXL04_016324|OH1004|cDNA

ATGGCGGATGGAGTTCAAGAACTGGAACTACAACCCAGAGGTATGAATAGCATCGCTAATGGAGTCCAGAGTCCAAAAACCAAACATTACAGATGGTGGTTCCGGGTGGCGGTCTATATCATCTTCCTAATCTCCGGCCAAGCCACCGCCACCCTCTTGGGCAGACTTTACTACGACGAAGGCGGAAACAGTAAATGGATCTCGACTTTCGTCCAATCCGCCGGATTCCCAATCTTAATTCCCCTCCTATTCTTCTTCCA...

CDS

Download CDS FASTA

1134 bp · LXL04_016324|LXL04_016324|OH1004|CDS

ATGGCGGATGGAGTTCAAGAACTGGAACTACAACCCAGAGGTATGAATAGCATCGCTAATGGAGTCCAGAGTCCAAAAACCAAACATTACAGATGGTGGTTCCGGGTGGCGGTCTATATCATCTTCCTAATCTCCGGCCAAGCCACCGCCACCCTCTTGGGCAGACTTTACTACGACGAAGGCGGAAACAGTAAATGGATCTCGACTTTCGTCCAATCCGCCGGATTCCCAATCTTAATTCCCCTCCTATTCTTCTTCCA...

Protein

Download Protein FASTA

377 aa · LXL04_016324|LXL04_016324|OH1004|PROTEIN

MADGVQELELQPRGMNSIANGVQSPKTKHYRWWFRVAVYIIFLISGQATATLLGRLYYDEGGNSKWISTFVQSAGFPILIPLLFFFQPTTTSAATPPPPPTTTLLLLYIFFGLILTGDNLMYSYGLQYLPVSTYSLICATQLAFNAVFSFLFNSQKFTALIINSLVLLTISASLLAVHSDSDNPSKISKAKYVIGFLCTLGASATYSLYLSLLQLSFEKVIKSENFRVVLELQIYPSFVATCGCVVGLFASGEWDTLRKE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_016324`
TK1151 ID	TkA02G156160
OH-1004 ID	LXL04_016324
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 50.663 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_016324

Location Chr03:118934839-118935972 (+)

Description Similar to PUP11: Probable purine permease 11

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g44750`	Probable purine permease 11.	No verified direct reference in this release
`At4g18220`	Purine permease 21.	No verified direct reference in this release
`At4g18210`	Probable purine permease 10.	No verified direct reference in this release
`At4g08700`	Probable purine permease 13.	No verified direct reference in this release
`At4g18205`	Probable purine permease 22.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016324 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006863 purine nucleobase transport Biological Process

GO:0009624 response to nematode Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0005345 purine nucleobase transmembrane transporter activity Molecular Function

GO:0015211 purine nucleoside transmembrane transporter activity Molecular Function

GO:0022857 transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G44750

ath:AT4G08700

ath:AT4G18205

ath:AT4G18210

ath:AT4G18220

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.414

Rank 1 · LXL04_016324 · OH-1004

Lysosome / Vacuole0.264

Rank 2 · LXL04_016324 · OH-1004

Endoplasmic reticulum0.183

Rank 3 · LXL04_016324 · OH-1004

Golgi apparatus0.087

Rank 4 · LXL04_016324 · OH-1004

Cytoplasm0.074

Rank 5 · LXL04_016324 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16913.12PUNUT35-351 aa

PF00892.27EamA48-175 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_016324	`PF16913.12`	PUNUT	35	351	1e-127	426.6
LXL04_016324	`PF00892.27`	EamA	48	175	5.5e-06	27.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LPF6`	Arabidopsis thaliana	Probable purine permease 11	56.598%	Swiss-Prot	strong database homology
`O49726`	Arabidopsis thaliana	Purine permease 21	55.793%	Swiss-Prot	strong database homology
`O49725`	Arabidopsis thaliana	Probable purine permease 10	55.623%	Swiss-Prot	strong database homology
`Q8RY83`	Arabidopsis thaliana	Probable purine permease 13	50.430%	Swiss-Prot	strong database homology
`Q8RY74`	Arabidopsis thaliana	Probable purine permease 22	52.616%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card