LXL04_015492 | RubberDandelionOmics

Gene overview

LXL04_015492

Reference: OH-1004 Chr: Chr03 Coordinates: 73577089-73582821 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5049 bp · LXL04_015492|LXL04_015492|OH1004|cDNA

ATGAAGCATCACCATCATCAGACATCATCCGAGGCCgtctcttctacatcatcagcAGAAACTGCAgtttcatcatcatcatcgtcgTCCTTGACGTCGTCATCACAGCAGCCGCCGCCTTCGCCGACCGTACAGCTAATGAATGCCACGTCTCCGGCGACTGAGGACCATCCTGCATCATCGTCGTCTCGTGATTGTTCCTCTTCCTCATCGTCGTCATCGTCGTCGTTGGAGTCCGTGACAATCGAGAGGCGAGGCGA...

CDS

Download CDS FASTA

5049 bp · LXL04_015492|LXL04_015492|OH1004|CDS

ATGAAGCATCACCATCATCAGACATCATCCGAGGCCGTCTCTTCTACATCATCAGCAGAAACTGCAGTTTCATCATCATCATCGTCGTCCTTGACGTCGTCATCACAGCAGCCGCCGCCTTCGCCGACCGTACAGCTAATGAATGCCACGTCTCCGGCGACTGAGGACCATCCTGCATCATCGTCGTCTCGTGATTGTTCCTCTTCCTCATCGTCGTCATCGTCGTCGTTGGAGTCCGTGACAATCGAGAGGCGAGGCGA...

Protein

Download Protein FASTA

1682 aa · LXL04_015492|LXL04_015492|OH1004|PROTEIN

MKHHHHQTSSEAVSSTSSAETAVSSSSSSSLTSSSQQPPPSPTVQLMNATSPATEDHPASSSSRDCSSSSSSSSSSLESVTIERRGEFAAVCKWTIFNFPRVKTRALWSKYFEVGGYDCRLLVYPKGDSQALPGYISIYLQIMDPRGTSSSKWDCFASYRLTVVNPTDDSKSIHRDSWHRFSTKKKSHGWCDFTPSGSILDTKSGFMFNDDHCVLITADILILNESINFVRDNNELQSNSVSNSVVMTGPVGDVLSGKFT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_015492`
TK1151 ID	TkA02G326210
OH-1004 ID	LXL04_015492
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.500
Protein coverage (%)	TK1151 97.325 / OH-1004 97.325 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_015492

Location Chr03:73577089-73582821 (-)

Description Similar to UBP13: Ubiquitin carboxyl-terminal hydrolase 13

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g11910`	Recognizes and hydrolyzes the peptide bond at the C-terminal Gly of ubiquitin.	No verified direct reference in this release
`At5g06600`	Recognizes and hydrolyzes the peptide bond at the C-terminal Gly of ubiquitin.	No verified direct reference in this release
`At3g58210`	MATH domain and coiled-coil domain-containing protein At3g58210.	No verified direct reference in this release
`At3g58340`	MATH domain and coiled-coil domain-containing protein At3g58340.	No verified direct reference in this release
`At3g58410`	MATH domain and coiled-coil domain-containing protein At3g58410.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015492 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009867 jasmonic acid mediated signaling pathway Biological Process

GO:0010078 maintenance of root meristem identity Biological Process

GO:0016579 protein deubiquitination Biological Process

GO:0031647 regulation of protein stability Biological Process

GO:0070646 protein modification by small protein removal Biological Process

GO:2000280 regulation of root development Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0004843 cysteine-type deubiquitinase activity Molecular Function

KEGG gene cross-reference

ath:AT3G11910

ath:AT3G58210

ath:AT5G06600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.565

Rank 1 · LXL04_015492 · OH-1004

Cytoplasm0.369

Rank 2 · LXL04_015492 · OH-1004

Cell membrane0.130

Rank 3 · LXL04_015492 · OH-1004

Endoplasmic reticulum0.063

Rank 4 · LXL04_015492 · OH-1004

Golgi apparatus0.049

Rank 5 · LXL04_015492 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22486.3MATH_293-214 aa

PF00917.33MATH106-218 aa

PF22486.3MATH_2258-389 aa

PF22486.3MATH_2425-559 aa

PF00917.33MATH455-561 aa

PF22486.3MATH_2592-714 aa

PF14631.12FancD2759-874 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_015492	`PF22486.3`	MATH_2	93	214	5.8e-87	289.6
LXL04_015492	`PF00917.33`	MATH	106	218	5.8e-26	91.7
LXL04_015492	`PF22486.3`	MATH_2	258	389	5.8e-87	289.6
LXL04_015492	`PF22486.3`	MATH_2	425	559	5.8e-87	289.6
LXL04_015492	`PF00917.33`	MATH	455	561	5.8e-26	91.7
LXL04_015492	`PF22486.3`	MATH_2	592	714	5.8e-87	289.6
LXL04_015492	`PF14631.12`	FancD2	759	874	4e-16	58.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84WU2`	Arabidopsis thaliana	Ubiquitin C-terminal hydrolase 13	35.971%	Swiss-Prot	weak database homology
`Q9FPT1`	Arabidopsis thaliana	Ubiquitin C-terminal hydrolase 12	35.252%	Swiss-Prot	weak database homology
`Q9M2J5`	Arabidopsis thaliana	MATH domain and coiled-coil domain-containing protein At3g58210	35.000%	Swiss-Prot	weak database homology
`Q9M2I2`	Arabidopsis thaliana	MATH domain and coiled-coil domain-containing protein At3g58340	33.813%	Swiss-Prot	weak database homology
`Q9M2H5`	Arabidopsis thaliana	MATH domain and coiled-coil domain-containing protein At3g58410	33.333%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card