LXL04_015196 | RubberDandelionOmics

Gene overview

LXL04_015196

Reference: OH-1004 Chr: Chr03 Coordinates: 65694804-65696077 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1182 bp · LXL04_015196|LXL04_015196|OH1004|cDNA

ATGGAGTCTATTTCTATGCATTCTTTACGAAGTTTCCCTCTCACATCAGTCCGCAACCCATTTGGCAAGACTACCACTTCACATCAATGTGTCAATAACATGCTTACACATGCTACTGCAACAACACCACCGTCAACCACCACTCACCGCCATACCGTTACCCACAAAATGCCACCGGAAAAAATTGAAGTTTTTAAGTCCCTCGAGCCTTGGGTTGCCCAATCCATCCTCCCTCTTCTAAAATCAACAGAACAGTCCTG...

CDS

Download CDS FASTA

1182 bp · LXL04_015196|LXL04_015196|OH1004|CDS

ATGGAGTCTATTTCTATGCATTCTTTACGAAGTTTCCCTCTCACATCAGTCCGCAACCCATTTGGCAAGACTACCACTTCACATCAATGTGTCAATAACATGCTTACACATGCTACTGCAACAACACCACCGTCAACCACCACTCACCGCCATACCGTTACCCACAAAATGCCACCGGAAAAAATTGAAGTTTTTAAGTCCCTCGAGCCTTGGGTTGCCCAATCCATCCTCCCTCTTCTAAAATCAACAGAACAGTCCTG...

Protein

Download Protein FASTA

393 aa · LXL04_015196|LXL04_015196|OH1004|PROTEIN

MESISMHSLRSFPLTSVRNPFGKTTTSHQCVNNMLTHATATTPPSTTTHRHTVTHKMPPEKIEVFKSLEPWVAQSILPLLKSTEQSWQPSDFLPNSSQSTDQFTTEVQILRDQSANLPDDYLVVLIGNMITEEALPTYQTVFNTFHGVNDETGASPSPWATWTRSWTAEENRHGDLLRTYLYLSGRVNMTMIERTVQNLIASGMDPGTENNPYLGFVYTSFQERATFISHGNTARLAKENGDPSLARICGIIASDEKRHE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_015196`
TK1151 ID	TkA02G357100
OH-1004 ID	LXL04_015196
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 99.746 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_015196

Location Chr03:65694804-65696077 (+)

Description Similar to S-ACP-DES6: Stearoyl-[acyl-carrier-protein] 9-desaturase 6, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g43800`	Converts stearoyl-ACP to oleoyl-ACP by introduction of a cis double bond between carbons 9 and 10 of the acyl chain.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0880800`	Converts stearoyl-ACP to oleoyl-ACP by introduction of a cis double bond between carbons 9 and 10 of the acyl chain.	No verified direct reference in this release
`UniProt: B8A7A3`	Converts stearoyl-ACP to oleoyl-ACP by introduction of a cis double bond between carbons 9 and 10 of the acyl chain.	No verified direct reference in this release
`Os04g0379900`	Converts stearoyl-ACP to oleoyl-ACP by introduction of a cis double bond between carbons 9 and 10 of the acyl chain.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015196 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006631 fatty acid metabolic process Biological Process

GO:0006633 fatty acid biosynthetic process Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0045300 stearoyl-[ACP] desaturase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G43800

dosa:Os01g0880800

dosa:Os04g0379900

sot:102577562

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.859

Rank 1 · LXL04_015196 · OH-1004

Mitochondrion0.134

Rank 2 · LXL04_015196 · OH-1004

Cytoplasm0.078

Rank 3 · LXL04_015196 · OH-1004

Nucleus0.051

Rank 4 · LXL04_015196 · OH-1004

Peroxisome0.028

Rank 5 · LXL04_015196 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03405.21FA_desaturase_260-387 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_015196	`PF03405.21`	FA_desaturase_2	60	387	3.8e-147	490.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84VY3`	Arabidopsis thaliana	Stearoyl-[acyl-carrier-protein] 9-desaturase 6, chloroplastic	70.206%	Swiss-Prot	strong database homology
`Q8LJJ9`	Oryza sativa subsp. japonica	Stearoyl-[acyl-carrier-protein] 9-desaturase 1, chloroplastic	65.797%	Swiss-Prot	strong database homology
`B8A7A3`	Oryza sativa subsp. indica	Stearoyl-[acyl-carrier-protein] 9-desaturase 1, chloroplastic	65.797%	Swiss-Prot	strong database homology
`Q40731`	Oryza sativa subsp. japonica	Stearoyl-[acyl-carrier-protein] 9-desaturase 5, chloroplastic	60.606%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card