LXL04_015073 | RubberDandelionOmics

Gene overview

LXL04_015073

Reference: OH-1004 Chr: Chr03 Coordinates: 63034337-63036749 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1716 bp · LXL04_015073|LXL04_015073|OH1004|cDNA

ATGGGAAGATCTACCGGATATTGCTTCAAAATCATTGCCTGTGGCAGCAGCTCTGAATCCATCGATAGAGACGATCTTGATGCTTCTTCGGAGAATAAAGCAACCCCCGATAAAAGAGGCTGGAGTTTTCGTAAAAAACCATCAGGACATCGAGTGCTAAACAACACCATTATAACCGAAACTCAAACACCTTCTGATGATAAAAAAATCTCGGAACCTGTCATTATCAACTCAGAACCACCCGTCAATTCATCCGAATC...

CDS

Download CDS FASTA

1716 bp · LXL04_015073|LXL04_015073|OH1004|CDS

ATGGGAAGATCTACCGGATATTGCTTCAAAATCATTGCCTGTGGCAGCAGCTCTGAATCCATCGATAGAGACGATCTTGATGCTTCTTCGGAGAATAAAGCAACCCCCGATAAAAGAGGCTGGAGTTTTCGTAAAAAACCATCAGGACATCGAGTGCTAAACAACACCATTATAACCGAAACTCAAACACCTTCTGATGATAAAAAAATCTCGGAACCTGTCATTATCAACTCAGAACCACCCGTCAATTCATCCGAATC...

Protein

Download Protein FASTA

571 aa · LXL04_015073|LXL04_015073|OH1004|PROTEIN

MGRSTGYCFKIIACGSSSESIDRDDLDASSENKATPDKRGWSFRKKPSGHRVLNNTIITETQTPSDDKKISEPVIINSEPPVNSSESEKTSTNQWTEEFSRVSTSTTNDNTTPSKLVTKADDIKSYSSHDESSSIIVIQTAVRKFLGEREYLRLKNVVKLQAVVRGHLVRCHAAGALRCIHAIVKMQALVRVRYSKRLSLGEKGIQSSNMKPHPTYISIEKLLSNRFANQLIESTPQTKQINIKCDPSKQDQTWKWLERW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_015073`
TK1151 ID	TkA02G370670
OH-1004 ID	LXL04_015073
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_015073

Location Chr03:63034337-63036749 (-)

Description Similar to IQD32: Protein IQ-DOMAIN 32

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g19870`	May be involved in cooperative interactions with calmodulins or calmodulin-like proteins (By similarity).	No verified direct reference in this release
`At1g74690`	May be involved in cooperative interactions with calmodulins or calmodulin-like proteins (By similarity).	No verified direct reference in this release
`At1g18840`	May be involved in cooperative interactions with calmodulins or calmodulin-like proteins (By similarity).	No verified direct reference in this release
`At1g14380`	May be involved in cooperative interactions with calmodulins or calmodulin-like proteins (By similarity).	No verified direct reference in this release
`At2g02790`	May be involved in cooperative interactions with calmodulins or calmodulin-like proteins (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015073 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005856 cytoskeleton Cellular Component

GO:0005875 microtubule associated complex Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0005516 calmodulin binding Molecular Function

KEGG gene cross-reference

ath:AT1G18840

ath:AT1G19870

ath:AT1G74690

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.457

Rank 1 · LXL04_015073 · OH-1004

Cell membrane0.333

Rank 2 · LXL04_015073 · OH-1004

Nucleus0.331

Rank 3 · LXL04_015073 · OH-1004

Endoplasmic reticulum0.054

Rank 4 · LXL04_015073 · OH-1004

Golgi apparatus0.042

Rank 5 · LXL04_015073 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FXI5`	Arabidopsis thaliana	Protein IQ-DOMAIN 32	39.130%	Swiss-Prot	weak database homology
`Q8L4D8`	Arabidopsis thaliana	Protein IQ-DOMAIN 31	27.074%	Swiss-Prot	weak database homology
`Q501D2`	Arabidopsis thaliana	Protein IQ-DOMAIN 30	27.169%	Swiss-Prot	weak database homology
`Q8GZ87`	Arabidopsis thaliana	Protein IQ-DOMAIN 28	26.809%	Swiss-Prot	weak database homology
`A0A1P8B0B7`	Arabidopsis thaliana	Protein IQ-DOMAIN 29	26.160%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card