LXL04_014739 | RubberDandelionOmics

Gene overview

LXL04_014739

Reference: OH-1004 Chr: Chr03 Coordinates: 56154219-56158717 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3525 bp · LXL04_014739|LXL04_014739|OH1004|cDNA

ATGGAGCGATCTCAGAAGTCTCATAGGTCTCGTCAATCTGGCCCTTCAGCCAAGAAGAAATCCGATACTGATAAGAGGAAACGTGGCCTCATTGAAGAGAAGCCTGATAAGACCAAAGAAAACAAATCCGATACTGATAAGAAGAAACGCGTCCCCACCAAAGAGAAGAATCAAAACCCTAAGGCATTCGCGTTTAATTCAACTGTAAAAGCTAAACGTCTACAGTCGCGTGCTTCAGAGAAAGAGCAGCGCCGCCTCCA...

CDS

Download CDS FASTA

3525 bp · LXL04_014739|LXL04_014739|OH1004|CDS

ATGGAGCGATCTCAGAAGTCTCATAGGTCTCGTCAATCTGGCCCTTCAGCCAAGAAGAAATCCGATACTGATAAGAGGAAACGTGGCCTCATTGAAGAGAAGCCTGATAAGACCAAAGAAAACAAATCCGATACTGATAAGAAGAAACGCGTCCCCACCAAAGAGAAGAATCAAAACCCTAAGGCATTCGCGTTTAATTCAACTGTAAAAGCTAAACGTCTACAGTCGCGTGCTTCAGAGAAAGAGCAGCGCCGCCTCCA...

Protein

Download Protein FASTA

1174 aa · LXL04_014739|LXL04_014739|OH1004|PROTEIN

MERSQKSHRSRQSGPSAKKKSDTDKRKRGLIEEKPDKTKENKSDTDKKKRVPTKEKNQNPKAFAFNSTVKAKRLQSRASEKEQRRLHIPTIDRNTGEPAPYVIVVHGPPQVGKSLLIKSLVKHYTKHNIPDVRGPITIVSGKQRRLQFVECPNDINGMIDAAKFADLALVLIDGSYGFEMETFEFLNIMQVHGFPKVMGVLTHLDKFKDVKKLKKTKQRLKHRFWTEIYDGAKLFYLSGLIHGKYVKREVHNLARFISVM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014739`
TK1151 ID	TkA02G400370
OH-1004 ID	LXL04_014739
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_014739`
Location	Chr03:56154219-56158717 (-)
Description	Similar to bms1: Ribosome biogenesis protein bms1 (Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_014739` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0000462 maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0000472 endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0000479 endonucleolytic cleavage of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0000480 endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) Biological Process GO:0030490 maturation of SSU-rRNA Biological Process GO:0042255 ribosome assembly Biological Process GO:0042274 ribosomal small subunit biogenesis Biological Process GO:2000232 regulation of rRNA processing Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005694 chromosome Cellular Component GO:0005730 nucleolus Cellular Component
KEGG gene cross-reference	hsa:642517 hsa:9790 sce:YPL217C spo:2540390 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.906

Rank 1 · LXL04_014739 · OH-1004

Cytoplasm0.137

Rank 2 · LXL04_014739 · OH-1004

Mitochondrion0.028

Rank 3 · LXL04_014739 · OH-1004

Cell membrane0.022

Rank 4 · LXL04_014739 · OH-1004

Endoplasmic reticulum0.010

Rank 5 · LXL04_014739 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08142.19AARP2CN261-334 aa

PF04950.19RIBIOP_C699-1015 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014739	`PF08142.19`	AARP2CN	261	334	2.3e-28	98.3
LXL04_014739	`PF04950.19`	RIBIOP_C	699	1015	9e-86	288.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card