LXL04_014455 | RubberDandelionOmics

Gene overview

LXL04_014455

Reference: OH-1004 Chr: Chr03 Coordinates: 49514222-49522083 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

6021 bp · LXL04_014455|LXL04_014455|OH1004|cDNA

ATGTCATCCCTAAAGCATGCTGTTCATAGAAGGACCCATAAGGAACGATCTCAACCaaaagaaaggaaaagaTTTGGACTTCTTGAAAAACACAAGGACTATGTTGTCCGTGCAAAGGCCTTTCATAAAAAAGAGGATTACTTGCAGAAACTGAAGGAAAAGGCAGCATTCAAGAATCCAGATGAATTCTACTTCAAGATGATCAACTCCAAGACTGTTAATGGAGTACATAAACAGGCGGGTGACCCAAATCAATACTC...

CDS

Download CDS FASTA

6021 bp · LXL04_014455|LXL04_014455|OH1004|CDS

ATGTCATCCCTAAAGCATGCTGTTCATAGAAGGACCCATAAGGAACGATCTCAACCAAAAGAAAGGAAAAGATTTGGACTTCTTGAAAAACACAAGGACTATGTTGTCCGTGCAAAGGCCTTTCATAAAAAAGAGGATTACTTGCAGAAACTGAAGGAAAAGGCAGCATTCAAGAATCCAGATGAATTCTACTTCAAGATGATCAACTCCAAGACTGTTAATGGAGTACATAAACAGGCGGGTGACCCAAATCAATACTC...

Protein

Download Protein FASTA

2006 aa · LXL04_014455|LXL04_014455|OH1004|PROTEIN

MSSLKHAVHRRTHKERSQPKERKRFGLLEKHKDYVVRAKAFHKKEDYLQKLKEKAAFKNPDEFYFKMINSKTVNGVHKQAGDPNQYSQEELLLIKSQDIGYILQKVQSEKKKIEKLTATLHSLDSQPSNRHVYYAEDREDAKRIISERKSDGGFKAFEDLPVKIKRKTASSYRELEARRGRVEELEKVYNEMAMKQELRKKGKKRKLREDEIVNPSSRPVYKWRTEQSEWREVRRRRNSRPKPFHGSSDDPAVTSFFMKG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014455`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014455

Location Chr03:49514222-49522083 (-)

Description Similar to Os01g0810000: Probable U3 small nucleolar RNA-associated protein 11

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g60360`	Involved in nucleolar processing of pre-18S ribosomal RNA.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0810000`	Involved in nucleolar processing of pre-18S ribosomal RNA.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014455 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006310 DNA recombination Biological Process

GO:0006364 rRNA processing Biological Process

GO:0009561 megagametogenesis Biological Process

GO:0032197 retrotransposition Biological Process

GO:0090304 nucleic acid metabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0032040 small-subunit processome Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003824 catalytic activity Molecular Function

GO:0003964 RNA-directed DNA polymerase activity Molecular Function

GO:0009036 type II site-specific deoxyribonuclease activity Molecular Function

KEGG gene cross-reference

ath:AT3G60360

dosa:Os01g0810000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.652

Rank 1 · LXL04_014455 · OH-1004

Cytoplasm0.298

Rank 2 · LXL04_014455 · OH-1004

Cell membrane0.064

Rank 3 · LXL04_014455 · OH-1004

Plastid0.027

Rank 4 · LXL04_014455 · OH-1004

Endoplasmic reticulum0.022

Rank 5 · LXL04_014455 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03998.20Utp1110-226 aa

PF03372.30Exo_endo_phos853-1016 aa

PF00078.33RVT_11298-1549 aa

PF13966.12zf-RVT1839-1902 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014455	`PF03998.20`	Utp11	10	226	2.4e-55	188.8
LXL04_014455	`PF03372.30`	Exo_endo_phos	853	1016	1.2e-07	32.5
LXL04_014455	`PF00078.33`	RVT_1	1298	1549	7.8e-33	114.8
LXL04_014455	`PF13966.12`	zf-RVT	1839	1902	2.4e-10	41.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9M223`	Arabidopsis thaliana	Probable U3 small nucleolar RNA-associated protein 11	57.269%	Swiss-Prot	weak database homology
`Q8S1Z1`	Oryza sativa subsp. japonica	Probable U3 small nucleolar RNA-associated protein 11	62.115%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card