LXL04_014323 | RubberDandelionOmics

Gene overview

LXL04_014323

Reference: OH-1004 Chr: Chr03 Coordinates: 46180858-46181856 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

948 bp · LXL04_014323|LXL04_014323|OH1004|cDNA

ATGACCCAACTGAAGCCAATTCACTCTCACGTCGATAACATCCCGTCGACCGCCGGAAAATTCAAACCCGACAAATCTTCTCTCTATTACATCTACTATCGTCTCCGGTACCAAACTTCCTTCCCCAAATTTACAATTTGGTTGACCATGTTTCTCTCATTGATTGTTCTGTTCTTCTTCTTATCCCCTCCTGCCACCCCCGCCCCCCGTCGTGGCCTCCGTACAACCAATTCCGACAAAGGATCAGGATGGGAGAGCCG...

CDS

Download CDS FASTA

948 bp · LXL04_014323|LXL04_014323|OH1004|CDS

ATGACCCAACTGAAGCCAATTCACTCTCACGTCGATAACATCCCGTCGACCGCCGGAAAATTCAAACCCGACAAATCTTCTCTCTATTACATCTACTATCGTCTCCGGTACCAAACTTCCTTCCCCAAATTTACAATTTGGTTGACCATGTTTCTCTCATTGATTGTTCTGTTCTTCTTCTTATCCCCTCCTGCCACCCCCGCCCCCCGTCGTGGCCTCCGTACAACCAATTCCGACAAAGGATCAGGATGGGAGAGCCG...

Protein

Download Protein FASTA

315 aa · LXL04_014323|LXL04_014323|OH1004|PROTEIN

MTQLKPIHSHVDNIPSTAGKFKPDKSSLYYIYYRLRYQTSFPKFTIWLTMFLSLIVLFFFLSPPATPAPRRGLRTTNSDKGSGWESRIKLSAKPRFPNWSYSGDGVVGLDSKVPFSEKDRTDQPASLYAATKKAGLRFFTVYGPWGRPDMAYFFFTKDILNRKQISIFEGPNHGTIARDFTYIDDIVNGCLSAIDTTKKSTGTGGKKKGEAQFRIINLGNTSHVSFYKLVNILEKLLKVKTRKNMVLMPRNGDVPITHAN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014323`
TK1151 ID	TkA02G439230
OH-1004 ID	LXL04_014323
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	88.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014323

Location Chr03:46180858-46181856 (+)

Description Similar to GAE2: UDP-glucuronate 4-epimerase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g02000`	Involved in the synthesis of the negatively charged monosaccharide that forms the backbone of pectic cell wall components.	No verified direct reference in this release
`At2g45310`	Involved in the synthesis of the negatively charged monosaccharide that forms the backbone of pectic cell wall components.	No verified direct reference in this release
`At4g00110`	Involved in the synthesis of the negatively charged monosaccharide that forms the backbone of pectic cell wall components.	No verified direct reference in this release
`At3g23820`	Involved in the synthesis of the negatively charged monosaccharide that forms the backbone of pectic cell wall components.	Identification and characterization of a UDP-D-glucuronate 4-epimerase in Arabidopsis.2004 · DOI: 10.1016/j.febslet.2004.06.005
`At4g12250`	Involved in the synthesis of the negatively charged monosaccharide that forms the backbone of pectic cell wall components.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014323 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0016020 membrane Cellular Component

GO:0032580 Golgi cisterna membrane Cellular Component

GO:0016854 racemase and epimerase activity Molecular Function

GO:0050378 UDP-glucuronate 4-epimerase activity Molecular Function

KEGG gene cross-reference

ath:AT1G02000

ath:AT2G45310

ath:AT4G00110

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.305

Rank 1 · LXL04_014323 · OH-1004

Cytoplasm0.150

Rank 2 · LXL04_014323 · OH-1004

Golgi apparatus0.129

Rank 3 · LXL04_014323 · OH-1004

Extracellular0.119

Rank 4 · LXL04_014323 · OH-1004

Nucleus0.117

Rank 5 · LXL04_014323 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01370.28Epimerase134-198 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014323	`PF01370.28`	Epimerase	134	198	1.3e-07	32.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LPC1`	Arabidopsis thaliana	UDP-glucuronate 4-epimerase 2	68.852%	Swiss-Prot	moderate database homology
`O22141`	Arabidopsis thaliana	UDP-glucuronate 4-epimerase 4	68.852%	Swiss-Prot	moderate database homology
`O81312`	Arabidopsis thaliana	UDP-glucuronate 4-epimerase 3	67.760%	Swiss-Prot	moderate database homology
`Q9LIS3`	Arabidopsis thaliana	UDP-glucuronate 4-epimerase 6	61.202%	Swiss-Prot	moderate database homology
`Q9STI6`	Arabidopsis thaliana	UDP-glucuronate 4-epimerase 5	64.615%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card