LXL04_014237 | RubberDandelionOmics

Gene overview

LXL04_014237

Reference: OH-1004 Chr: Chr03 Coordinates: 44182849-44187249 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2400 bp · LXL04_014237|LXL04_014237|OH1004|cDNA

ATGTGTGGACCAGTCTTGATTGGCTACCCTTTTGGGATCGGAAGAAACTGCTCTGCCAATAAATGGTTCAATGTTGATTGCAATTCCTCAATACCGTATCTATCTGCGTTCAACAACATGGAGGTGTTGCGTGCAGAGAAGAGAAGGGTCACTGTTAATACCTCTGTTATTAAGGTTGATTGCAAGAATCCAATCCTACATAGCAATATCAGCCATGGCAAAAGCCCCTTCTTGCTTTCCGGATTGAACAACATATTGGT...

CDS

Download CDS FASTA

2400 bp · LXL04_014237|LXL04_014237|OH1004|CDS

ATGTGTGGACCAGTCTTGATTGGCTACCCTTTTGGGATCGGAAGAAACTGCTCTGCCAATAAATGGTTCAATGTTGATTGCAATTCCTCAATACCGTATCTATCTGCGTTCAACAACATGGAGGTGTTGCGTGCAGAGAAGAGAAGGGTCACTGTTAATACCTCTGTTATTAAGGTTGATTGCAAGAATCCAATCCTACATAGCAATATCAGCCATGGCAAAAGCCCCTTCTTGCTTTCCGGATTGAACAACATATTGGT...

Protein

Download Protein FASTA

799 aa · LXL04_014237|LXL04_014237|OH1004|PROTEIN

MCGPVLIGYPFGIGRNCSANKWFNVDCNSSIPYLSAFNNMEVLRAEKRRVTVNTSVIKVDCKNPILHSNISHGKSPFLLSGLNNILVVEGCGGAAIMENRSIVAGCSTTCGNNTISDLNYCFGVGCCNTVIPHDLQSLTLNLTGSTSNGRETCGSALLVDTDSFMNERVSRQFVVEDHTFVPISLSWNHNTTECNNTCGEVMIPYPFGIGKSCSQDNWYNVDCNSSTAYLSAFNNIQVLGVNIESQTVTVNFSKISDCEK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_014237`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_014237

Location Chr03:44182849-44187249 (-)

Description Similar to WAKL2: Wall-associated receptor kinase-like 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g16130`	Serine/threonine-protein kinase that may function as a signaling receptor of extracellular matrix component.	No verified direct reference in this release
`At1g16120`	Serine/threonine-protein kinase that may function as a signaling receptor of extracellular matrix component.	No verified direct reference in this release
`At1g16260`	Serine/threonine-protein kinase that may function as a signaling receptor of extracellular matrix component.	No verified direct reference in this release
`At1g16150`	Serine/threonine-protein kinase that may function as a signaling receptor of extracellular matrix component.	No verified direct reference in this release
`At1g79670`	Serine/threonine-protein kinase that may function as a signaling receptor of extracellular matrix component.	RESISTANCE TO FUSARIUM OXYSPORUM 1, a dominant Arabidopsis disease-resistance gene, is not race specific.2005 · DOI: 10.1534/genetics.105.042218

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_014237 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0007166 cell surface receptor signaling pathway Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005509 calcium ion binding Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0030247 polysaccharide binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G16120

ath:AT1G16130

ath:AT1G16260

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.860

Rank 1 · LXL04_014237 · OH-1004

Cytoplasm0.082

Rank 2 · LXL04_014237 · OH-1004

Endoplasmic reticulum0.069

Rank 3 · LXL04_014237 · OH-1004

Nucleus0.047

Rank 4 · LXL04_014237 · OH-1004

Lysosome / Vacuole0.030

Rank 5 · LXL04_014237 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13947.12GUB_WAK_bind2-46 aa

PF08488.17WAK120-193 aa

PF13947.12GUB_WAK_bind194-250 aa

PF00069.32Pkinase503-769 aa

PF07714.24PK_Tyr_Ser-Thr506-773 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_014237	`PF13947.12`	GUB_WAK_bind	2	46	1e-16	61.8
LXL04_014237	`PF08488.17`	WAK	120	193	9.6e-10	39.6
LXL04_014237	`PF13947.12`	GUB_WAK_bind	194	250	1e-16	61.8
LXL04_014237	`PF00069.32`	Pkinase	503	769	7.8e-47	160.6
LXL04_014237	`PF07714.24`	PK_Tyr_Ser-Thr	506	773	2.2e-45	155.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q7X8C5`	Arabidopsis thaliana	Wall-associated receptor kinase-like 2	44.478%	Swiss-Prot	moderate database homology
`Q9S9M5`	Arabidopsis thaliana	Wall-associated receptor kinase-like 1	42.438%	Swiss-Prot	moderate database homology
`Q9SA25`	Arabidopsis thaliana	Wall-associated receptor kinase-like 8	43.730%	Swiss-Prot	moderate database homology
`Q9S9M2`	Arabidopsis thaliana	Wall-associated receptor kinase-like 4	42.411%	Swiss-Prot	moderate database homology
`Q8RY17`	Arabidopsis thaliana	Wall-associated receptor kinase-like 22	42.066%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card