LXL04_013718 | RubberDandelionOmics

Gene overview

LXL04_013718

Reference: OH-1004 Chr: Chr03 Coordinates: 34570429-34575889 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1785 bp · LXL04_013718|LXL04_013718|OH1004|cDNA

ATGGATAATACCGTATCCACAGCCCAACACGTCAACTCGAGGCCTGCATTAGTAGTTAAGAACTTAAGATTATCGCAGATGCAGGACAGGAGTCAAAATCAGACCAGAGGCGATAAGCTCAAGTGTAACCACCTGTCTTTTTCTCTACATTTAAGAAGTATCCTTCTTCCTCTTCAACTGAGGCACATGGCGATGGCTCCAATATGCTTTAAAATGTGCTACAAAAACCGAACTGTAAACAATGATCAAGATGTTTTTCG...

CDS

Download CDS FASTA

1785 bp · LXL04_013718|LXL04_013718|OH1004|CDS

ATGGATAATACCGTATCCACAGCCCAACACGTCAACTCGAGGCCTGCATTAGTAGTTAAGAACTTAAGATTATCGCAGATGCAGGACAGGAGTCAAAATCAGACCAGAGGCGATAAGCTCAAGTGTAACCACCTGTCTTTTTCTCTACATTTAAGAAGTATCCTTCTTCCTCTTCAACTGAGGCACATGGCGATGGCTCCAATATGCTTTAAAATGTGCTACAAAAACCGAACTGTAAACAATGATCAAGATGTTTTTCG...

Protein

Download Protein FASTA

594 aa · LXL04_013718|LXL04_013718|OH1004|PROTEIN

MDNTVSTAQHVNSRPALVVKNLRLSQMQDRSQNQTRGDKLKCNHLSFSLHLRSILLPLQLRHMAMAPICFKMCYKNRTVNNDQDVFRGISPNSIGTFINPNKSMLKCANFPRYISASSSQREKPLESSSREKQLRSLDSYFRKSKNDMNHNISGQSNKQLPLLNIYPVKNIQESQSKAGNQAVTKSESDETSGLYMISTIVSINIAVYLFEIASPIKNSDLELFSLPALYGAKINHLILYGEWWRLLTPMFLHTGIIHIG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013718`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013718

Location Chr03:34570429-34575889 (-)

Description Similar to RBL9: RHOMBOID-like protein 9, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g38510`	Probable rhomboid-type serine protease that catalyzes intramembrane proteolysis.	No verified direct reference in this release
`At1g25290`	Rhomboid-type serine protease that catalyzes intramembrane proteolysis.	Rhomboid proteins in the chloroplast envelope affect the level of allene oxide synthase in Arabidopsis thaliana.2012 · DOI: 10.1111/j.1365-313x.2012.05090.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0381400`	May be involved in abiotic stress response through abscisic acid-dependent signaling.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013718 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0006654 phosphatidic acid biosynthetic process Biological Process

GO:0019374 galactolipid metabolic process Biological Process

GO:0046473 phosphatidic acid metabolic process Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009706 chloroplast inner membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0031969 chloroplast membrane Cellular Component

GO:0004252 serine-type endopeptidase activity Molecular Function

GO:0008236 serine-type peptidase activity Molecular Function

KEGG gene cross-reference

ath:AT1G25290

ath:AT5G38510

bsu:BSU24870

dosa:Os05g0381400

psx:DR96_2293

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.592

Rank 1 · LXL04_013718 · OH-1004

Plastid0.172

Rank 2 · LXL04_013718 · OH-1004

Cytoplasm0.084

Rank 3 · LXL04_013718 · OH-1004

Endoplasmic reticulum0.070

Rank 4 · LXL04_013718 · OH-1004

Nucleus0.064

Rank 5 · LXL04_013718 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01694.29Rhomboid241-379 aa

PF05512.17AWPM-19434-560 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013718	`PF01694.29`	Rhomboid	241	379	1.9e-31	109.9
LXL04_013718	`PF05512.17`	AWPM-19	434	560	7.3e-40	137.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FFX0`	Arabidopsis thaliana	RHOMBOID-like protein 9, chloroplastic	45.317%	Swiss-Prot	weak database homology
`F4ICF4`	Arabidopsis thaliana	RHOMBOID-like protein 10, chloroplastic	24.883%	Swiss-Prot	weak database homology
`Q6L4D2`	Oryza sativa subsp. japonica	Membrane protein PM19L	52.308%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card