LXL04_013326 | RubberDandelionOmics

Gene overview

LXL04_013326

Reference: OH-1004 Chr: Chr03 Coordinates: 27828861-27847006 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

7191 bp · LXL04_013326|LXL04_013326|OH1004|cDNA

ATGAGTAAACAGAGCACCCAGACAATCAGGAAACACAGCAATGGATCTATCCGATCGATTTTCATGCATGCCGACGGTGCCGATATCTTTCTGATGAGTCTTGGTTTTTTAGGTGCCGTCGGCGATGGAATTGCAGCGCCAATCATGTTTTTTATTACCAGCACCATCATGAACAATATCGGAGACTTCTCTTCTTTATCCACCGATGTCTTCACTGACAAAATCAATAAGGATGCAGAGTATCTTTGTTTCTTGGCTAT...

CDS

Download CDS FASTA

7191 bp · LXL04_013326|LXL04_013326|OH1004|CDS

ATGAGTAAACAGAGCACCCAGACAATCAGGAAACACAGCAATGGATCTATCCGATCGATTTTCATGCATGCCGACGGTGCCGATATCTTTCTGATGAGTCTTGGTTTTTTAGGTGCCGTCGGCGATGGAATTGCAGCGCCAATCATGTTTTTTATTACCAGCACCATCATGAACAATATCGGAGACTTCTCTTCTTTATCCACCGATGTCTTCACTGACAAAATCAATAAGGATGCAGAGTATCTTTGTTTCTTGGCTAT...

Protein

Download Protein FASTA

2396 aa · LXL04_013326|LXL04_013326|OH1004|PROTEIN

MSKQSTQTIRKHSNGSIRSIFMHADGADIFLMSLGFLGAVGDGIAAPIMFFITSTIMNNIGDFSSLSTDVFTDKINKDAEYLCFLAIGKLIACFLEGYCWARTAERQASKLRLDYLKAVLRQEVAYFDLNVASTSEIITSISSDSLIIQEVISEKVPSFIMYVSICAGAYVVAFILLWRLAIVALPFITCLVIPGLIYGRVLMRLSRKIREEYNKAGMVAEQAISSVRTVYSFVGENKTLMEYSVSLQSSVKLGLKQGLA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_013326`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_013326

Location Chr03:27828861-27847006 (-)

Description Similar to ABCB15: ABC transporter B family member 15

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g28345`	ABC transporter B family member 15.	No verified direct reference in this release
`At3g28390`	ABC transporter B family member 18.	No verified direct reference in this release
`At3g28415`	ABC transporter B family member 22.	No verified direct reference in this release
`At3g28380`	ABC transporter B family member 17.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0190300`	Putative multidrug resistance protein.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_013326 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0055085 transmembrane transport Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0016020 membrane Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

GO:0042626 ATPase-coupled transmembrane transporter activity Molecular Function

GO:0140359 ABC-type transporter activity Molecular Function

KEGG gene cross-reference

ath:AT3G28345

ath:AT3G28390

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.506

Rank 1 · LXL04_013326 · OH-1004

Lysosome / Vacuole0.234

Rank 2 · LXL04_013326 · OH-1004

Endoplasmic reticulum0.131

Rank 3 · LXL04_013326 · OH-1004

Cytoplasm0.113

Rank 4 · LXL04_013326 · OH-1004

Golgi apparatus0.063

Rank 5 · LXL04_013326 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00664.29ABC_membrane34-298 aa

PF00005.34ABC_tran376-524 aa

PF00664.29ABC_membrane677-923 aa

PF00005.34ABC_tran1001-1150 aa

PF00664.29ABC_membrane1258-1462 aa

PF00005.34ABC_tran1536-1685 aa

PF02463.26SMC_N1572-1725 aa

PF00664.29ABC_membrane1822-2090 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_013326	`PF00664.29`	ABC_membrane	34	298	2.5e-177	589.0
LXL04_013326	`PF00005.34`	ABC_tran	376	524	1.5e-135	447.3
LXL04_013326	`PF00664.29`	ABC_membrane	677	923	2.5e-177	589.0
LXL04_013326	`PF00005.34`	ABC_tran	1001	1150	1.5e-135	447.3
LXL04_013326	`PF00664.29`	ABC_membrane	1258	1462	2.5e-177	589.0
LXL04_013326	`PF00005.34`	ABC_tran	1536	1685	1.5e-135	447.3
LXL04_013326	`PF02463.26`	SMC_N	1572	1725	1.5e-20	74.3
LXL04_013326	`PF00664.29`	ABC_membrane	1822	2090	2.5e-177	589.0
LXL04_013326	`PF00005.34`	ABC_tran	2163	2312	1.5e-135	447.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LHD1`	Arabidopsis thaliana	ABC transporter B family member 15	69.893%	Swiss-Prot	moderate database homology
`Q9LSJ5`	Arabidopsis thaliana	ABC transporter B family member 18	66.039%	Swiss-Prot	moderate database homology
`Q9LSJ2`	Arabidopsis thaliana	ABC transporter B family member 22	64.123%	Swiss-Prot	moderate database homology
`Q9LSJ6`	Arabidopsis thaliana	ABC transporter B family member 17	64.984%	Swiss-Prot	moderate database homology
`Q6YUU5`	Oryza sativa subsp. japonica	Putative multidrug resistance protein	65.872%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card