LXL04_012558 | RubberDandelionOmics

Gene overview

LXL04_012558

Reference: OH-1004 Chr: Chr03 Coordinates: 14581077-14582388 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

828 bp · LXL04_012558|LXL04_012558|OH1004|cDNA

ATGTGGACGATACCTTTGGGAATCTCAGTAAACACCCTCTCTCCCAACTTCAACAAATTACCTCTTTTCTACCCTTCCAGGGTTCATCAGTCGTCGTCTATCCCTTATCATCTGTACAGATCAGACTCACTAGGGATTTGCAAAGCGAGTCAAGTGGTAGAAATATTTCCGATCGTATCCCCCGAAATTGTGGTCCGTGAGGCAAGGATTGAAGACTGTTGGGAGGTTGCAGAAACACATTGTAGCTCCTTCTTCCCTGA...

CDS

Download CDS FASTA

828 bp · LXL04_012558|LXL04_012558|OH1004|CDS

ATGTGGACGATACCTTTGGGAATCTCAGTAAACACCCTCTCTCCCAACTTCAACAAATTACCTCTTTTCTACCCTTCCAGGGTTCATCAGTCGTCGTCTATCCCTTATCATCTGTACAGATCAGACTCACTAGGGATTTGCAAAGCGAGTCAAGTGGTAGAAATATTTCCGATCGTATCCCCCGAAATTGTGGTCCGTGAGGCAAGGATTGAAGACTGTTGGGAGGTTGCAGAAACACATTGTAGCTCCTTCTTCCCTGA...

Protein

Download Protein FASTA

275 aa · LXL04_012558|LXL04_012558|OH1004|PROTEIN

MWTIPLGISVNTLSPNFNKLPLFYPSRVHQSSSIPYHLYRSDSLGICKASQVVEIFPIVSPEIVVREARIEDCWEVAETHCSSFFPEYAFPLDFVLRIDRLLALVFGLSVPPGCRRTCLVAVTDTSQDDTNTFFIGDEDLKIAGFGAKISLNKGYVAGILTLDTVADFLPRKGPLRQRRTGIAYVSNVAVRERFRRKGIAKRLIAKAEAQARSWGCRSIALHCDLNNPGATNLYRSQGFKDIKVPEGAKWPQPRTSPDMQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012558`
TK1151 ID	TkA02G553330
OH-1004 ID	LXL04_012558
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012558

Location Chr03:14581077-14582388 (+)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g39000`	May participate in protein N-terminal and lysine acetylation.	Molecular identification and functional characterization of the first Nα-acetyltransferase in plastids by global acetylome profiling.2015 · DOI: 10.1002/pmic.201500025

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012558 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006474 N-terminal protein amino acid acetylation Biological Process

GO:0018394 peptidyl-lysine acetylation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004596 protein-N-terminal amino-acid acetyltransferase activity Molecular Function

GO:0008080 N-acetyltransferase activity Molecular Function

GO:0061733 protein-lysine-acetyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT2G39000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.980

Rank 1 · LXL04_012558 · OH-1004

Nucleus0.024

Rank 2 · LXL04_012558 · OH-1004

Mitochondrion0.023

Rank 3 · LXL04_012558 · OH-1004

Cytoplasm0.019

Rank 4 · LXL04_012558 · OH-1004

Cell membrane0.015

Rank 5 · LXL04_012558 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00583.32Acetyltransf_1129-239 aa

PF13508.14Acetyltransf_7166-240 aa

PF13673.14Acetyltransf_10181-244 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012558	`PF00583.32`	Acetyltransf_1	129	239	3.7e-17	63.4
LXL04_012558	`PF13508.14`	Acetyltransf_7	166	240	4.4e-11	43.7
LXL04_012558	`PF13673.14`	Acetyltransf_10	181	244	3e-08	34.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZV08`	Arabidopsis thaliana	GCN5-related N-acetyltransferase 4, chloroplastic	72.065%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card