LXL04_012402 | RubberDandelionOmics

Gene overview

LXL04_012402

Reference: OH-1004 Chr: Chr03 Coordinates: 11648109-11652330 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2448 bp · LXL04_012402|LXL04_012402|OH1004|cDNA

ATGTATAGAAGGAAGATGAAAAAAGCTAGTATTGATATGAGTGAAATAACGGAGTTCTTGAATCAATTATATGTGGAAAAACCTCTTTTTCCATTGGTGATTCCTTTGTTATTGGTTTTATGGAGCATTGAGAAATGGGTTTTCAACCTCTCGAATTGGGTTCCTCTTGCTGTTGCCGTCTGGGCAACTATTCAGTATGGAAGTTATCGACAACGAATTGTTGTGCAAGACTTGAACAAAAAGTGGAAGCAACTCATTTT...

CDS

Download CDS FASTA

2448 bp · LXL04_012402|LXL04_012402|OH1004|CDS

ATGTATAGAAGGAAGATGAAAAAAGCTAGTATTGATATGAGTGAAATAACGGAGTTCTTGAATCAATTATATGTGGAAAAACCTCTTTTTCCATTGGTGATTCCTTTGTTATTGGTTTTATGGAGCATTGAGAAATGGGTTTTCAACCTCTCGAATTGGGTTCCTCTTGCTGTTGCCGTCTGGGCAACTATTCAGTATGGAAGTTATCGACAACGAATTGTTGTGCAAGACTTGAACAAAAAGTGGAAGCAACTCATTTT...

Protein

Download Protein FASTA

815 aa · LXL04_012402|LXL04_012402|OH1004|PROTEIN

MYRRKMKKASIDMSEITEFLNQLYVEKPLFPLVIPLLLVLWSIEKWVFNLSNWVPLAVAVWATIQYGSYRQRIVVQDLNKKWKQLILQTSPTTPLEHCEWLNKLLIEVWPNFISPKLSLKFSSIVEKRLKHRKTKLIERIELQEFSLGSLPPILGMHGAQWSTAGDQRFIRMGFDWDTTDISIMLFAKLAKPMGTARIVVNNIHIKGDLLISPILEGRAVLYSFVSTPEVRIGVAFGSGGSQSLPATELPGVSSWLVKIC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_012402`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_012402

Location Chr03:11648109-11652330 (-)

Description Similar to Mctp1: Multiple C2 and transmembrane domain-containing protein 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g05500`	May be involved in membrane trafficking.	No verified direct reference in this release
`At5g11100`	May be involved in membrane trafficking.	No verified direct reference in this release
`At1g53590`	C2 domain-containing protein At1g53590.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_012402 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006869 lipid transport Biological Process

GO:0030336 negative regulation of cell migration Biological Process

GO:0045806 negative regulation of endocytosis Biological Process

GO:1902883 negative regulation of response to oxidative stress Biological Process

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0012505 endomembrane system Cellular Component

GO:0016020 membrane Cellular Component

GO:0033011 perinuclear theca Cellular Component

GO:0055037 recycling endosome Cellular Component

KEGG gene cross-reference

ath:AT1G05500

rno:309928

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.304

Rank 1 · LXL04_012402 · OH-1004

Cytoplasm0.244

Rank 2 · LXL04_012402 · OH-1004

Endoplasmic reticulum0.209

Rank 3 · LXL04_012402 · OH-1004

Golgi apparatus0.180

Rank 4 · LXL04_012402 · OH-1004

Nucleus0.156

Rank 5 · LXL04_012402 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00168.37C2473-569 aa

PF00168.37C2599-696 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_012402	`PF00168.37`	C2	473	569	3.6e-41	140.3
LXL04_012402	`PF00168.37`	C2	599	696	3.6e-41	140.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L706`	Arabidopsis thaliana	Synaptotagmin-5	27.273%	Swiss-Prot	weak database homology
`A0JJX5`	Arabidopsis thaliana	Synaptotagmin-4	25.676%	Swiss-Prot	weak database homology
`Q93XX4`	Arabidopsis thaliana	C2 domain-containing protein At1g53590	33.636%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card