LXL04_011905 | RubberDandelionOmics

Gene overview

LXL04_011905

Reference: OH-1004 Chr: Chr03 Coordinates: 2553379-2557139 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2229 bp · LXL04_011905|LXL04_011905|OH1004|cDNA

ATGGGGACGTCGGTGCAAGTGACGCCACTATGTGGAGTGTACAATGAAAACCCATTATCATATCTGGTCTCCATCGATGGCTTCAACTTTCTTATTGATTGTGGTTGGAACGATCACTTTGACCCCTCCCTCCTTCAACCTCTATCCAGGGTTGCCTCAACGATAGATGCTGTGTTGTTGTCACATTCAGATACGCTACATCTTGGTGCTTTACCCTATGCCATGAAACAATTCGGACTTTCTGCTCCAGTTTATGCAAC...

CDS

Download CDS FASTA

2229 bp · LXL04_011905|LXL04_011905|OH1004|CDS

ATGGGGACGTCGGTGCAAGTGACGCCACTATGTGGAGTGTACAATGAAAACCCATTATCATATCTGGTCTCCATCGATGGCTTCAACTTTCTTATTGATTGTGGTTGGAACGATCACTTTGACCCCTCCCTCCTTCAACCTCTATCCAGGGTTGCCTCAACGATAGATGCTGTGTTGTTGTCACATTCAGATACGCTACATCTTGGTGCTTTACCCTATGCCATGAAACAATTCGGACTTTCTGCTCCAGTTTATGCAAC...

Protein

Download Protein FASTA

742 aa · LXL04_011905|LXL04_011905|OH1004|PROTEIN

MGTSVQVTPLCGVYNENPLSYLVSIDGFNFLIDCGWNDHFDPSLLQPLSRVASTIDAVLLSHSDTLHLGALPYAMKQFGLSAPVYATEPVFRLGLLTMYDHYLSRKQVSEFDLFTLDDIDSAFQNVTRLTYSQNCHLSGKGEGIVIAPHVAGHLLGGTVWKITKDGEDVIYAVDFNHRKERHLNGTVLESFVRPAVLITDAYNALSNQPSRRQRDQEFIDAILNTLRGNGNVLLPVDTAGRILELLLILEQYWEQHHLTY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011905`
TK1151 ID	TkA02G604910
OH-1004 ID	LXL04_011905
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011905

Location Chr03:2553379-2557139 (+)

Description Similar to CPSF100: Cleavage and polyadenylation specificity factor subunit 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g23880`	CPSF plays a key role in pre-mRNA 3'-end formation, recognizing the AAUAAA signal sequence and interacting with poly(A)polymerase and other factors to bring about cleavage and poly(A) addition (By similarity).	Defective RNA processing enhances RNA silencing and influences flowering of Arabidopsis.2006 · DOI: 10.1073/pnas.0606536103

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0569400`	CPSF plays a key role in pre-mRNA 3'-end formation, recognizing the AAUAAA signal sequence and interacting with poly(A)polymerase and other factors to bring about cleavage and poly(A) addition.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011905 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006398 mRNA 3'-end processing by stem-loop binding and cleavage Biological Process

GO:0031124 mRNA 3'-end processing Biological Process

GO:0035194 regulatory ncRNA-mediated post-transcriptional gene silencing Biological Process

GO:0071045 nuclear histone mRNA catabolic process Biological Process

GO:0180010 co-transcriptional mRNA 3'-end processing, cleavage and polyadenylation pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005847 mRNA cleavage and polyadenylation specificity factor complex Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0003723 RNA binding Molecular Function

KEGG gene cross-reference

ath:AT5G23880

bta:327689

dme:Dmel_CG1957

dosa:Os09g0569400

mmu:51786

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.667

Rank 1 · LXL04_011905 · OH-1004

Cytoplasm0.343

Rank 2 · LXL04_011905 · OH-1004

Golgi apparatus0.080

Rank 3 · LXL04_011905 · OH-1004

Lysosome / Vacuole0.068

Rank 4 · LXL04_011905 · OH-1004

Endoplasmic reticulum0.043

Rank 5 · LXL04_011905 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00753.34Lactamase_B19-180 aa

PF16661.12Lactamase_B_622-198 aa

PF10996.15Beta-Casp243-365 aa

PF07521.18RMMBL536-586 aa

PF13299.12CPSF100_C646-739 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011905	`PF00753.34`	Lactamase_B	19	180	5e-07	30.6
LXL04_011905	`PF16661.12`	Lactamase_B_6	22	198	1.1e-56	192.1
LXL04_011905	`PF10996.15`	Beta-Casp	243	365	3.1e-22	80.1
LXL04_011905	`PF07521.18`	RMMBL	536	586	3e-10	40.7
LXL04_011905	`PF13299.12`	CPSF100_C	646	739	4.1e-23	83.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LKF9`	Arabidopsis thaliana	Cleavage and polyadenylation specificity factor subunit 2	77.748%	Swiss-Prot	strong database homology
`Q652P4`	Oryza sativa subsp. japonica	Cleavage and polyadenylation specificity factor subunit 2	74.029%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card