LXL04_011437 | RubberDandelionOmics

Gene overview

LXL04_011437

Reference: OH-1004 Chr: Chr02 Coordinates: 164164796-164173996 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

645 bp · LXL04_011437|LXL04_011437|OH1004|cDNA

ATGGGGCGGAGGAAAGTCGAAATTAAGCGGATCCACGATAAGAGTAGCAGGGTAGTGACATTTTCAAAGAGGAGAGCAGGATTATTCAAGAAAGCGAGACACATTTCTGTGCTCTGTGACGTTGATGTCGCCGTCATCGTATTCTCCGATCGCGGCAAGCTATACGAGGTCTGTAGCGGTCGTCGTACTAACAGTGTGGGGCTTATGTTTTCCAGGTATCAGAATAGTTGCCTTGAGGGCGAAGAGAAAACTAGCCTAGA...

CDS

Download CDS FASTA

645 bp · LXL04_011437|LXL04_011437|OH1004|CDS

ATGGGGCGGAGGAAAGTCGAAATTAAGCGGATCCACGATAAGAGTAGCAGGGTAGTGACATTTTCAAAGAGGAGAGCAGGATTATTCAAGAAAGCGAGACACATTTCTGTGCTCTGTGACGTTGATGTCGCCGTCATCGTATTCTCCGATCGCGGCAAGCTATACGAGGTCTGTAGCGGTCGTCGTACTAACAGTGTGGGGCTTATGTTTTCCAGGTATCAGAATAGTTGCCTTGAGGGCGAAGAGAAAACTAGCCTAGA...

Protein

Download Protein FASTA

214 aa · LXL04_011437|LXL04_011437|OH1004|PROTEIN

MGRRKVEIKRIHDKSSRVVTFSKRRAGLFKKARHISVLCDVDVAVIVFSDRGKLYEVCSGRRTNSVGLMFSRYQNSCLEGEEKTSLEVELDNPSTKFRTCKELLEMIIPHIDRIDEEPNEVSLTYMIELEEELNDALLHTRSRKTQLMTERMSTFHEQERKLIEENEKLEQEVGVAKKNGYVDYGDEGVDDFPNGHYNYETNPYPLSSLPLFKE

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011437`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011437

Location Chr02:164164796-164173996 (+)

Description Similar to AGL70: Agamous-like MADS-box protein AGL70

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g65060`	Probable transcription factor involved in the negative regulation of flowering time, probably through the photoperiodic and vernalization pathways; more efficient in cv.	No verified direct reference in this release
`At5g65050`	Probable transcription factor that prevents vernalization by short periods of cold.	No verified direct reference in this release
`At5g65080`	Transcription factor involved in the negative regulation of flowering time in short days, probably through the photoperiodic and vernalization pathways.	Analysis of the Arabidopsis MADS AFFECTING FLOWERING gene family: MAF2 prevents vernalization by short periods of cold.2003 · DOI: 10.1105/tpc.009506 The E2 ubiquitin-conjugating enzymes, AtUBC1 and AtUBC2, play redundant roles and are involved in activation of FLC expression and repression of flowering in Arabidopsis thaliana.2009 · DOI: 10.1111/j.1365-313x.2008.03684.x The Plant Homeo Domain finger protein, VIN3-LIKE 2, is necessary for photoperiod-mediated epigenetic regulation of the floral repressor, MAF5.2010 · DOI: 10.1073/pnas.1010834107 Role of VIN3-LIKE 2 in facultative photoperiodic flowering response in Arabidopsis.2010 · DOI: 10.4161/psb.5.12.14035 AGAMOUS-LIKE 6 is a floral promoter that negatively regulates the FLC/MAF clade genes and positively regulates FT in Arabidopsis.2011 · DOI: 10.1111/j.1365-313x.2010.04402.x HISTONE DEACETYLASE6 interacts with FLOWERING LOCUS D and regulates flowering in Arabidopsis.2011 · DOI: 10.1104/pp.111.174417 Arabidopsis trithorax-related3/SET domain GROUP2 is required for the winter-annual habit of Arabidopsis thaliana.2012 · DOI: 10.1093/pcp/pcs021

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0682200`	Probable transcription factor.	MOSAIC FLORAL ORGANS1, an AGL6-like MADS box gene, regulates floral organ identity and meristem fate in rice.2009 · DOI: 10.1105/tpc.109.068742

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011437 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0009553 embryo sac development Biological Process

GO:0009908 flower development Biological Process

GO:0009910 negative regulation of flower development Biological Process

GO:0010022 meristem determinacy Biological Process

GO:0010048 vernalization response Biological Process

GO:0010093 specification of floral organ identity Biological Process

GO:0010094 specification of carpel identity Biological Process

GO:0010221 negative regulation of vernalization response Biological Process

GO:0010582 floral meristem determinacy Biological Process

KEGG gene cross-reference

ath:AT5G65050

ath:AT5G65060

ath:AT5G65080

dosa:Os02g0682200

sly:101268317

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.963

Rank 1 · LXL04_011437 · OH-1004

Cytoplasm0.104

Rank 2 · LXL04_011437 · OH-1004

Cell membrane0.021

Rank 3 · LXL04_011437 · OH-1004

Endoplasmic reticulum0.012

Rank 4 · LXL04_011437 · OH-1004

Plastid0.012

Rank 5 · LXL04_011437 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00319.24SRF-TF10-56 aa

PF01486.23K-box116-173 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011437	`PF00319.24`	SRF-TF	10	56	1.1e-22	79.9
LXL04_011437	`PF01486.23`	K-box	116	173	1e-07	32.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LSR7`	Arabidopsis thaliana	Agamous-like MADS-box protein AGL70	41.919%	Swiss-Prot	moderate database homology
`Q9FPN7`	Arabidopsis thaliana	Agamous-like MADS-box protein AGL31	40.291%	Swiss-Prot	moderate database homology
`Q683D7`	Arabidopsis thaliana	Protein MADS AFFECTING FLOWERING 5	38.028%	Swiss-Prot	moderate database homology
`Q6EU39`	Oryza sativa subsp. japonica	MADS-box transcription factor 6	40.659%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card