LXL04_011302 | RubberDandelionOmics

Gene overview

LXL04_011302

Reference: OH-1004 Chr: Chr02 Coordinates: 162241934-162247802 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

753 bp · LXL04_011302|LXL04_011302|OH1004|cDNA

ATGGTATTCCCTTATAAAACCCACCTACGATGTGCTACACCTAGAGCGATAGAAATAGAGATAAGGGTTATATTCAGATTCAGAGAAATTCTCCGTCGGAAGTTGCGTAGAAATTCGCCGATGGGGCGGAGGAAGCTCGAAATAATGCGGATCGAAGACAAGAGTAGCAGACTGGTGACGTTTTCGAAGCGGAGAACGGGTTTGATTAAGAAAGCACGACAGCTTTCCGTGCTCTGCGACGTCGACGTCGCCGTCATTGT...

CDS

Download CDS FASTA

753 bp · LXL04_011302|LXL04_011302|OH1004|CDS

ATGGTATTCCCTTATAAAACCCACCTACGATGTGCTACACCTAGAGCGATAGAAATAGAGATAAGGGTTATATTCAGATTCAGAGAAATTCTCCGTCGGAAGTTGCGTAGAAATTCGCCGATGGGGCGGAGGAAGCTCGAAATAATGCGGATCGAAGACAAGAGTAGCAGACTGGTGACGTTTTCGAAGCGGAGAACGGGTTTGATTAAGAAAGCACGACAGCTTTCCGTGCTCTGCGACGTCGACGTCGCCGTCATTGT...

Protein

Download Protein FASTA

250 aa · LXL04_011302|LXL04_011302|OH1004|PROTEIN

MVFPYKTHLRCATPRAIEIEIRVIFRFREILRRKLRRNSPMGRRKLEIMRIEDKSSRLVTFSKRRTGLIKKARQLSVLCDVDVAVIVFSARGKLYEFCSGGTANSVEHLLARYEANANRTINGNAQDLEVPLECTKFRTCKELLHTVDRLVEENNSEELSVTDMTQLEEELDAALTLTRSRKTQLMMEYISTLQQQQERNLIKEQEEIVQETASAEKVFGAGDDEGGGRNDLAINQMDSPKHATLPLFHS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011302`
TK1151 ID	TkA03G581530
OH-1004 ID	LXL04_011302
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 84.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011302

Location Chr02:162241934-162247802 (-)

Description Similar to AGL31: Agamous-like MADS-box protein AGL31

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g65050`	Probable transcription factor that prevents vernalization by short periods of cold.	No verified direct reference in this release
`At1g77080`	Probable transcription factor involved in the negative regulation of flowering time in both long and short days, probably through the photoperiodic and vernalization pathways.	No verified direct reference in this release
`At5g65060`	Probable transcription factor involved in the negative regulation of flowering time, probably through the photoperiodic and vernalization pathways; more efficient in cv.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0215400`	Probable transcription factor involved in the development of floral organs.	leafy hull sterile1 is a homeotic mutation in a rice MADS box gene affecting rice flower development.2000 · DOI: 10.1105/tpc.12.6.871 Ectopic expression of rice OsMADS1 reveals a role in specifying the lemma and palea, grass floral organs analogous to sepals.2001 · DOI: 10.1007/s004270100153 Conservation of the E-function for floral organ identity in rice revealed by the analysis of tissue culture-induced loss-of-function mutants of the OsMADS1 gene.2005 · DOI: 10.1007/s11103-005-2161-y Early flowering and reduced apical dominance result from ectopic expression of a rice MADS box gene.1994 · DOI: 10.1007/bf00013751
`UniProt: A2XDY1`	Probable transcription factor involved in the development of floral organs.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011302 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0009908 flower development Biological Process

GO:0009909 regulation of flower development Biological Process

GO:0009910 negative regulation of flower development Biological Process

GO:0010022 meristem determinacy Biological Process

GO:0010048 vernalization response Biological Process

GO:0010093 specification of floral organ identity Biological Process

GO:0010221 negative regulation of vernalization response Biological Process

GO:0010582 floral meristem determinacy Biological Process

GO:0030154 cell differentiation Biological Process

KEGG gene cross-reference

ath:AT1G77080

ath:AT5G65050

ath:AT5G65060

dosa:Os03g0215400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.945

Rank 1 · LXL04_011302 · OH-1004

Cytoplasm0.109

Rank 2 · LXL04_011302 · OH-1004

Cell membrane0.030

Rank 3 · LXL04_011302 · OH-1004

Endoplasmic reticulum0.020

Rank 4 · LXL04_011302 · OH-1004

Plastid0.014

Rank 5 · LXL04_011302 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00319.24SRF-TF50-97 aa

PF01486.23K-box134-210 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011302	`PF00319.24`	SRF-TF	50	97	5.9e-25	87.2
LXL04_011302	`PF01486.23`	K-box	134	210	1.6e-08	35.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FPN7`	Arabidopsis thaliana	Agamous-like MADS-box protein AGL31	38.942%	Swiss-Prot	moderate database homology
`Q9AT76`	Arabidopsis thaliana	Agamous-like MADS-box protein AGL27	42.105%	Swiss-Prot	moderate database homology
`Q9LSR7`	Arabidopsis thaliana	Agamous-like MADS-box protein AGL70	40.984%	Swiss-Prot	moderate database homology
`Q10PZ9`	Oryza sativa subsp. japonica	MADS-box transcription factor 1	39.524%	Swiss-Prot	moderate database homology
`A2XDY1`	Oryza sativa subsp. indica	MADS-box transcription factor 1	39.524%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card