LXL04_011198 | RubberDandelionOmics

Gene overview

LXL04_011198

Reference: OH-1004 Chr: Chr02 Coordinates: 159814871-159816070 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1200 bp · LXL04_011198|LXL04_011198|OH1004|cDNA

aTGGATTACGAATTTCCTACGAGCAACAACGAAACCGTCATGGTCTATTCAAACAAGGAACCAAATAGAGAAAATCTTGATTCAAATCACGAACAAGAGGCAGCGATGTTTGGGAATTTTCCGTTGCCTTTCCATGATGAGATatcttctaacacaaaaccgCAAAACCACCATGGCCATCGGCTTAGCACCGATAGATCAAAAACACCAAGAAGCAGCACGGCAAACGATCCAGCTGATCAACCTCCGCCATCGCTGGC...

CDS

Download CDS FASTA

1200 bp · LXL04_011198|LXL04_011198|OH1004|CDS

ATGGATTACGAATTTCCTACGAGCAACAACGAAACCGTCATGGTCTATTCAAACAAGGAACCAAATAGAGAAAATCTTGATTCAAATCACGAACAAGAGGCAGCGATGTTTGGGAATTTTCCGTTGCCTTTCCATGATGAGATATCTTCTAACACAAAACCGCAAAACCACCATGGCCATCGGCTTAGCACCGATAGATCAAAAACACCAAGAAGCAGCACGGCAAACGATCCAGCTGATCAACCTCCGCCATCGCTGGC...

Protein

Download Protein FASTA

399 aa · LXL04_011198|LXL04_011198|OH1004|PROTEIN

MDYEFPTSNNETVMVYSNKEPNRENLDSNHEQEAAMFGNFPLPFHDEISSNTKPQNHHGHRLSTDRSKTPRSSTANDPADQPPPSLATKTVRVRKKRSAGKKDRHSKIHTAQGLRDRRMRLSLHIARKFFGLQDMLGFDKASKTIEWLFSKSKKAIEEVTEGVKSQNTTQSVSNENMIERCQSPLSDCVLDSDIEFNPAASIKGKQLMIQDDEMENWNSRKPTEIDILARESRYKARARARERTRERMMINNFEKSTQMF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011198`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011198

Location Chr02:159814871-159816070 (-)

Description Similar to TCP12: Transcription factor TCP12

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g68800`	Transcription factor that prevents axillary bud outgrowth.	No verified direct reference in this release
`At1g67260`	Involved in petal morphogenesis.	Control of corolla monosymmetry in the Brassicaceae Iberis amara.2007 · DOI: 10.1073/pnas.0705338104

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0706500`	Probable transcription factor that functions as a negative regulator of lateral branching, presumably through its expression in axillary buds.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011198 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009908 flower development Biological Process

GO:0010075 regulation of meristem growth Biological Process

GO:0048831 regulation of shoot system development Biological Process

GO:1902347 response to strigolactone Biological Process

GO:2000032 regulation of secondary shoot formation Biological Process

GO:0005634 nucleus Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0043565 sequence-specific DNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G67260

ath:AT1G68800

dosa:Os03g0706500

osa:4333856

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.970

Rank 1 · LXL04_011198 · OH-1004

Cytoplasm0.099

Rank 2 · LXL04_011198 · OH-1004

Cell membrane0.024

Rank 3 · LXL04_011198 · OH-1004

Endoplasmic reticulum0.014

Rank 4 · LXL04_011198 · OH-1004

Plastid0.011

Rank 5 · LXL04_011198 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03634.20TCP100-249 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011198	`PF03634.20`	TCP	100	249	1.6e-44	152.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`A0AQW4`	Arabidopsis thaliana	Transcription factor TCP12	72.603%	Swiss-Prot	weak database homology
`Q9FYG7`	Arabidopsis thaliana	Transcription factor TCP1	39.634%	Swiss-Prot	weak database homology
`Q8LN68`	Oryza sativa subsp. japonica	Transcription factor TB1	42.581%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card