LXL04_011006 | RubberDandelionOmics

Gene overview

LXL04_011006

Reference: OH-1004 Chr: Chr02 Coordinates: 156283292-156286531 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2135 bp · LXL04_011006|LXL04_011006|OH1004|cDNA

CAACCCATACCCCCTTTCAGAAACCGCCCATACGTCTTCTTGATACAAATCCCCAAATTTTCTGCCAATTCCTCTCTTTTCTTATCACCATGgattcatcatcatcttcatcaatgGATCGGGTCAACTTCAGGACACAAGTCCTAACGCGACATCTCAAAAACCACCATAACGCCGCCACCGATCTCCTACACACCGTCCCATGTGTCAGTTACTCCCCACCGGAACTCTCTGAGCCGCCGCTTAATTTCGATACCAAA...

CDS

Download CDS FASTA

2046 bp · LXL04_011006|LXL04_011006|OH1004|CDS

ATGGATTCATCATCATCTTCATCAATGGATCGGGTCAACTTCAGGACACAAGTCCTAACGCGACATCTCAAAAACCACCATAACGCCGCCACCGATCTCCTACACACCGTCCCATGTGTCAGTTACTCCCCACCGGAACTCTCTGAGCCGCCGCTTAATTTCGATACCAAATTGCTCCGTAAGCTCCTAGACGGTCAGAACATTGCCGAAATTGACTATGTGTTCAATCTGATGATGCAAAGCAACCTGTTTTGCCCAAG...

Protein

Download Protein FASTA

681 aa · LXL04_011006|LXL04_011006|OH1004|PROTEIN

MDSSSSSSMDRVNFRTQVLTRHLKNHHNAATDLLHTVPCVSYSPPELSEPPLNFDTKLLRKLLDGQNIAEIDYVFNLMMQSNLFCPRERGGKVFISPDFNQSMEQQREMTMRRIDYLREQGAFDGWFSKKGPEGELWRFALAESATVFDHSLGIKLGVHFFLWGGAIRFMGTKRHHDKWFKPTETYEVKGCFAMTELGHGSNVRGIETITRYDASTQEFIISTPCESAQKYWIGGAANHATHTIVFSQLEINGVNQGVHA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_011006`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_011006

Location Chr02:156283292-156286531 (+)

Description Similar to ACX3: Acyl-coenzyme A oxidase 3, peroxisomal

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g06290`	Catalyzes the desaturation of medium-chain acyl-CoAs to 2-trans-enoyl-CoAs.	No verified direct reference in this release
`At1g06310`	Catalyzes the desaturation of acyl-CoAs to 2-trans-enoyl-CoAs.	No verified direct reference in this release
`At5g65110`	Catalyzes the desaturation of long-chain acyl-CoAs to 2- trans-enoyl-CoAs.	Long-chain acyl-CoA oxidases of Arabidopsis.1999 · DOI: 10.1046/j.1365-313x.1999.00559.x

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_011006 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0001676 long-chain fatty acid metabolic process Biological Process

GO:0006635 fatty acid beta-oxidation Biological Process

GO:0033540 fatty acid beta-oxidation using acyl-CoA oxidase Biological Process

GO:0051791 medium-chain fatty acid metabolic process Biological Process

GO:0055088 lipid homeostasis Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009514 glyoxysome Cellular Component

GO:0003997 acyl-CoA oxidase activity Molecular Function

GO:0005504 fatty acid binding Molecular Function

KEGG gene cross-reference

ath:AT1G06290

ath:AT1G06310

ath:AT5G65110

mmu:74121

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Peroxisome0.725

Rank 1 · LXL04_011006 · OH-1004

Cytoplasm0.153

Rank 2 · LXL04_011006 · OH-1004

Mitochondrion0.146

Rank 3 · LXL04_011006 · OH-1004

Nucleus0.059

Rank 4 · LXL04_011006 · OH-1004

Endoplasmic reticulum0.036

Rank 5 · LXL04_011006 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02770.25Acyl-CoA_dh_M191-299 aa

PF00441.30Acyl-CoA_dh_1333-489 aa

PF22924.2ACOX_C_alpha1338-489 aa

PF01756.25ACOX534-665 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_011006	`PF02770.25`	Acyl-CoA_dh_M	191	299	1.1e-10	42.2
LXL04_011006	`PF00441.30`	Acyl-CoA_dh_1	333	489	1.8e-09	38.6
LXL04_011006	`PF22924.2`	ACOX_C_alpha1	338	489	1.6e-41	142.6
LXL04_011006	`PF01756.25`	ACOX	534	665	1.7e-17	64.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P0CZ23`	Arabidopsis thaliana	Acyl-coenzyme A oxidase 3, peroxisomal	70.074%	Swiss-Prot	strong database homology
`Q9LMI7`	Arabidopsis thaliana	Putative acyl-coenzyme A oxidase 3.2, peroxisomal	69.162%	Swiss-Prot	strong database homology
`O65201`	Arabidopsis thaliana	Acyl-coenzyme A oxidase 2, peroxisomal	36.204%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card